Incidental Mutation 'R7639:Miip'
ID 590122
Institutional Source Beutler Lab
Gene Symbol Miip
Ensembl Gene ENSMUSG00000029022
Gene Name migration and invasion inhibitory protein
Synonyms D4Wsu114e
MMRRC Submission 045697-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R7639 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 147945235-147953176 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 147947021 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 244 (M244K)
Ref Sequence ENSEMBL: ENSMUSP00000113897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030886] [ENSMUST00000119975] [ENSMUST00000172710]
AlphaFold A2A7Y5
Predicted Effect probably benign
Transcript: ENSMUST00000030886
AA Change: M244K

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030886
Gene: ENSMUSG00000029022
AA Change: M244K

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119975
AA Change: M244K

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113897
Gene: ENSMUSG00000029022
AA Change: M244K

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Pfam:MIIP 41 382 1.4e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172710
AA Change: M244K

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134085
Gene: ENSMUSG00000029022
AA Change: M244K

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the oncogene protein insulin-like growth factor binding protein 2 and may function as an inhibitor of cell migration and invasion. This protein also interacts with the cell division protein 20 and may be involved in regulating mitotic progression. This protein may function as a tumor suppressor by inhibiting the growth or certain cancers. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,977,531 (GRCm39) M381L probably benign Het
Abl1 T A 2: 31,669,173 (GRCm39) L184Q probably damaging Het
Atp8b1 A G 18: 64,697,614 (GRCm39) V410A possibly damaging Het
Bhmt2 C T 13: 93,799,822 (GRCm39) G205R probably damaging Het
Bicd1 A G 6: 149,414,502 (GRCm39) D405G possibly damaging Het
Brip1 A T 11: 86,043,648 (GRCm39) probably null Het
Ccdc180 A T 4: 45,928,043 (GRCm39) I1193F possibly damaging Het
Cdc14b A G 13: 64,353,143 (GRCm39) C478R possibly damaging Het
Celsr1 C T 15: 85,814,073 (GRCm39) E1950K probably benign Het
Cnot7 A G 8: 40,960,494 (GRCm39) probably null Het
Defa34 A T 8: 22,155,883 (GRCm39) K24I probably benign Het
Dsg4 G T 18: 20,582,769 (GRCm39) D136Y probably damaging Het
Dync2h1 C A 9: 7,141,254 (GRCm39) V1258F probably damaging Het
Erbb3 A G 10: 128,405,716 (GRCm39) S1181P probably damaging Het
Evl A G 12: 108,652,362 (GRCm39) D366G probably damaging Het
Fam234b A T 6: 135,202,798 (GRCm39) probably null Het
Fanca A G 8: 124,018,134 (GRCm39) probably null Het
Fbxo46 T A 7: 18,870,560 (GRCm39) V393E probably damaging Het
Gkap1 T G 13: 58,411,784 (GRCm39) K63T probably damaging Het
Hfm1 T A 5: 107,037,791 (GRCm39) D742V probably benign Het
Hfm1 A G 5: 107,046,341 (GRCm39) V515A possibly damaging Het
Itga10 G A 3: 96,556,898 (GRCm39) V207I probably benign Het
Lipi T A 16: 75,357,743 (GRCm39) Y274F probably benign Het
Mettl8 A T 2: 70,812,526 (GRCm39) S36R probably benign Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nav1 T C 1: 135,398,860 (GRCm39) N574S probably benign Het
Nlrc4 C T 17: 74,754,952 (GRCm39) probably null Het
Oas2 C T 5: 120,883,751 (GRCm39) W244* probably null Het
Oat A T 7: 132,168,530 (GRCm39) I163N probably damaging Het
Or7a41 A G 10: 78,871,206 (GRCm39) D192G probably damaging Het
Otop3 T C 11: 115,235,187 (GRCm39) M273T possibly damaging Het
Poln A C 5: 34,290,495 (GRCm39) V60G possibly damaging Het
Ppp1r13b G T 12: 111,800,049 (GRCm39) A699E probably damaging Het
Rims1 A T 1: 22,844,750 (GRCm39) M19K probably benign Het
Rnf145 T C 11: 44,422,184 (GRCm39) L89P probably damaging Het
Rock1 A G 18: 10,140,244 (GRCm39) S116P probably damaging Het
Rtn3 C T 19: 7,435,356 (GRCm39) C212Y probably benign Het
Smcp G A 3: 92,491,797 (GRCm39) P17S unknown Het
Syne2 A C 12: 75,981,273 (GRCm39) E1525A probably damaging Het
Tpra1 A G 6: 88,887,158 (GRCm39) D172G probably benign Het
Traf2 TAGA TA 2: 25,427,100 (GRCm39) probably null Het
Trpa1 T C 1: 14,957,137 (GRCm39) T760A probably benign Het
Unc13c T A 9: 73,840,450 (GRCm39) S134C probably damaging Het
Zfp729b C T 13: 67,739,971 (GRCm39) V765I probably benign Het
Other mutations in Miip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Miip APN 4 147,950,322 (GRCm39) missense probably damaging 1.00
IGL02134:Miip APN 4 147,949,735 (GRCm39) splice site probably benign
IGL02829:Miip APN 4 147,947,518 (GRCm39) missense probably benign 0.01
IGL03350:Miip APN 4 147,946,979 (GRCm39) missense probably benign 0.01
R0200:Miip UTSW 4 147,946,720 (GRCm39) missense probably damaging 0.99
R1647:Miip UTSW 4 147,949,691 (GRCm39) missense probably benign 0.02
R1783:Miip UTSW 4 147,950,231 (GRCm39) missense probably damaging 1.00
R1848:Miip UTSW 4 147,947,549 (GRCm39) missense probably damaging 0.99
R1944:Miip UTSW 4 147,950,422 (GRCm39) missense probably benign 0.15
R3615:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3616:Miip UTSW 4 147,950,371 (GRCm39) missense probably benign 0.00
R3882:Miip UTSW 4 147,945,509 (GRCm39) missense possibly damaging 0.93
R4579:Miip UTSW 4 147,945,518 (GRCm39) missense probably damaging 1.00
R5183:Miip UTSW 4 147,947,526 (GRCm39) missense probably damaging 1.00
R6054:Miip UTSW 4 147,950,135 (GRCm39) missense probably benign 0.00
R6056:Miip UTSW 4 147,946,792 (GRCm39) missense probably damaging 1.00
R6304:Miip UTSW 4 147,947,540 (GRCm39) missense probably benign 0.12
R6568:Miip UTSW 4 147,950,372 (GRCm39) missense probably benign
R6603:Miip UTSW 4 147,950,380 (GRCm39) missense possibly damaging 0.92
R7701:Miip UTSW 4 147,947,371 (GRCm39) missense probably null 0.86
R7795:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7796:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7797:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7872:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R7920:Miip UTSW 4 147,947,375 (GRCm39) missense probably benign 0.17
R8468:Miip UTSW 4 147,945,928 (GRCm39) missense probably damaging 1.00
R8492:Miip UTSW 4 147,945,881 (GRCm39) missense probably damaging 1.00
R8677:Miip UTSW 4 147,947,503 (GRCm39) missense probably damaging 1.00
R8852:Miip UTSW 4 147,950,839 (GRCm39) start gained probably benign
R8860:Miip UTSW 4 147,950,839 (GRCm39) start gained probably benign
R9755:Miip UTSW 4 147,950,319 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATGCTCACCCTGTGTAAG -3'
(R):5'- CCCTGACCTTTCATGTGGAAC -3'

Sequencing Primer
(F):5'- TCAGCAAGGGTCACACTCTG -3'
(R):5'- TGACCTTTCATGTGGAACCAAGAC -3'
Posted On 2019-10-24