Incidental Mutation 'R7639:Cnot7'
ID 590132
Institutional Source Beutler Lab
Gene Symbol Cnot7
Ensembl Gene ENSMUSG00000031601
Gene Name CCR4-NOT transcription complex, subunit 7
Synonyms Caf1
MMRRC Submission 045697-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.537) question?
Stock # R7639 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 40945581-40968888 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 40960494 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000034012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034012] [ENSMUST00000098817] [ENSMUST00000128166] [ENSMUST00000132032] [ENSMUST00000135269] [ENSMUST00000149992]
AlphaFold Q60809
Predicted Effect probably null
Transcript: ENSMUST00000034012
SMART Domains Protein: ENSMUSP00000034012
Gene: ENSMUSG00000031601

DomainStartEndE-ValueType
Pfam:CAF1 15 139 9.1e-15 PFAM
Pfam:CAF1 132 238 1.2e-14 PFAM
low complexity region 259 268 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098817
SMART Domains Protein: ENSMUSP00000096415
Gene: ENSMUSG00000031600

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Blast:UBCc 29 128 6e-6 BLAST
low complexity region 155 164 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Pfam:Mod_r 235 380 2.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128166
SMART Domains Protein: ENSMUSP00000123070
Gene: ENSMUSG00000039470

DomainStartEndE-ValueType
transmembrane domain 16 38 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
Pfam:zf-DHHC 122 248 1.8e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132032
SMART Domains Protein: ENSMUSP00000122933
Gene: ENSMUSG00000031601

DomainStartEndE-ValueType
Pfam:CAF1 13 240 3.4e-73 PFAM
low complexity region 259 268 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000135269
SMART Domains Protein: ENSMUSP00000119319
Gene: ENSMUSG00000031601

DomainStartEndE-ValueType
Pfam:CAF1 13 245 7e-66 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149992
SMART Domains Protein: ENSMUSP00000117304
Gene: ENSMUSG00000031601

DomainStartEndE-ValueType
Pfam:CAF1 13 240 3.4e-73 PFAM
low complexity region 259 268 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to an anti-proliferative protein, B-cell translocation protein 1, which negatively regulates cell proliferation. Binding of the two proteins, which is driven by phosphorylation of the anti-proliferative protein, causes signaling events in cell division that lead to changes in cell proliferation associated with cell-cell contact. The encoded protein downregulates the innate immune response and therefore provides a therapeutic target for enhancing its antimicrobial activity against foreign agents. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null mice display male sterility with oligo-teratozoospermia, impaired sperm motility, unsynchronized spermatid maturation, and Sertoli cell abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,977,531 (GRCm39) M381L probably benign Het
Abl1 T A 2: 31,669,173 (GRCm39) L184Q probably damaging Het
Atp8b1 A G 18: 64,697,614 (GRCm39) V410A possibly damaging Het
Bhmt2 C T 13: 93,799,822 (GRCm39) G205R probably damaging Het
Bicd1 A G 6: 149,414,502 (GRCm39) D405G possibly damaging Het
Brip1 A T 11: 86,043,648 (GRCm39) probably null Het
Ccdc180 A T 4: 45,928,043 (GRCm39) I1193F possibly damaging Het
Cdc14b A G 13: 64,353,143 (GRCm39) C478R possibly damaging Het
Celsr1 C T 15: 85,814,073 (GRCm39) E1950K probably benign Het
Defa34 A T 8: 22,155,883 (GRCm39) K24I probably benign Het
Dsg4 G T 18: 20,582,769 (GRCm39) D136Y probably damaging Het
Dync2h1 C A 9: 7,141,254 (GRCm39) V1258F probably damaging Het
Erbb3 A G 10: 128,405,716 (GRCm39) S1181P probably damaging Het
Evl A G 12: 108,652,362 (GRCm39) D366G probably damaging Het
Fam234b A T 6: 135,202,798 (GRCm39) probably null Het
Fanca A G 8: 124,018,134 (GRCm39) probably null Het
Fbxo46 T A 7: 18,870,560 (GRCm39) V393E probably damaging Het
Gkap1 T G 13: 58,411,784 (GRCm39) K63T probably damaging Het
Hfm1 T A 5: 107,037,791 (GRCm39) D742V probably benign Het
Hfm1 A G 5: 107,046,341 (GRCm39) V515A possibly damaging Het
Itga10 G A 3: 96,556,898 (GRCm39) V207I probably benign Het
Lipi T A 16: 75,357,743 (GRCm39) Y274F probably benign Het
Mettl8 A T 2: 70,812,526 (GRCm39) S36R probably benign Het
Miip A T 4: 147,947,021 (GRCm39) M244K probably benign Het
Muc4 C G 16: 32,575,221 (GRCm39) Q1269E probably benign Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nav1 T C 1: 135,398,860 (GRCm39) N574S probably benign Het
Nlrc4 C T 17: 74,754,952 (GRCm39) probably null Het
Oas2 C T 5: 120,883,751 (GRCm39) W244* probably null Het
Oat A T 7: 132,168,530 (GRCm39) I163N probably damaging Het
Or7a41 A G 10: 78,871,206 (GRCm39) D192G probably damaging Het
Otop3 T C 11: 115,235,187 (GRCm39) M273T possibly damaging Het
Poln A C 5: 34,290,495 (GRCm39) V60G possibly damaging Het
Ppp1r13b G T 12: 111,800,049 (GRCm39) A699E probably damaging Het
Rims1 A T 1: 22,844,750 (GRCm39) M19K probably benign Het
Rnf145 T C 11: 44,422,184 (GRCm39) L89P probably damaging Het
Rock1 A G 18: 10,140,244 (GRCm39) S116P probably damaging Het
Rtn3 C T 19: 7,435,356 (GRCm39) C212Y probably benign Het
Smcp G A 3: 92,491,797 (GRCm39) P17S unknown Het
Syne2 A C 12: 75,981,273 (GRCm39) E1525A probably damaging Het
Tpra1 A G 6: 88,887,158 (GRCm39) D172G probably benign Het
Traf2 TAGA TA 2: 25,427,100 (GRCm39) probably null Het
Trpa1 T C 1: 14,957,137 (GRCm39) T760A probably benign Het
Unc13c T A 9: 73,840,450 (GRCm39) S134C probably damaging Het
Zfp729b C T 13: 67,739,971 (GRCm39) V765I probably benign Het
Other mutations in Cnot7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Cnot7 APN 8 40,960,490 (GRCm39) splice site probably null
IGL02022:Cnot7 APN 8 40,952,386 (GRCm39) missense probably damaging 1.00
IGL02191:Cnot7 APN 8 40,963,068 (GRCm39) missense probably benign 0.33
R0047:Cnot7 UTSW 8 40,948,962 (GRCm39) splice site probably benign
R0047:Cnot7 UTSW 8 40,948,962 (GRCm39) splice site probably benign
R0166:Cnot7 UTSW 8 40,960,494 (GRCm39) critical splice donor site probably null
R3884:Cnot7 UTSW 8 40,963,171 (GRCm39) start codon destroyed probably null 0.01
R5369:Cnot7 UTSW 8 40,947,061 (GRCm39) missense probably benign 0.12
R5991:Cnot7 UTSW 8 40,948,696 (GRCm39) splice site probably null
R6101:Cnot7 UTSW 8 40,963,078 (GRCm39) missense probably benign
R6105:Cnot7 UTSW 8 40,963,078 (GRCm39) missense probably benign
R7299:Cnot7 UTSW 8 40,960,586 (GRCm39) missense probably damaging 1.00
R7548:Cnot7 UTSW 8 40,953,874 (GRCm39) missense probably damaging 1.00
R7712:Cnot7 UTSW 8 40,947,122 (GRCm39) missense probably damaging 1.00
R8069:Cnot7 UTSW 8 40,960,514 (GRCm39) missense possibly damaging 0.95
R8128:Cnot7 UTSW 8 40,963,129 (GRCm39) missense probably damaging 1.00
R8757:Cnot7 UTSW 8 40,947,080 (GRCm39) missense probably benign
R9251:Cnot7 UTSW 8 40,964,622 (GRCm39) unclassified probably benign
Z1088:Cnot7 UTSW 8 40,953,780 (GRCm39) critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- CCCAGGTTTAATCTGCAGCAC -3'
(R):5'- TGCAAGACCCATTGGAGAATTC -3'

Sequencing Primer
(F):5'- CAGGTTTAATCTGCAGCACCTTAAAC -3'
(R):5'- ACCCATTGGAGAATTCAGAAGC -3'
Posted On 2019-10-24