Incidental Mutation 'R7639:Erbb3'
ID590137
Institutional Source Beutler Lab
Gene Symbol Erbb3
Ensembl Gene ENSMUSG00000018166
Gene Nameerb-b2 receptor tyrosine kinase 3
SynonymsErbb-3, Erbb3r, HER3
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_010153.1; MGI:95411

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7639 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location128567523-128589652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128569847 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1181 (S1181P)
Ref Sequence ENSEMBL: ENSMUSP00000080716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026425] [ENSMUST00000082059] [ENSMUST00000131728]
Predicted Effect probably benign
Transcript: ENSMUST00000026425
SMART Domains Protein: ENSMUSP00000026425
Gene: ENSMUSG00000025364

DomainStartEndE-ValueType
Pfam:Peptidase_M24 19 293 2.1e-27 PFAM
low complexity region 359 377 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082059
AA Change: S1181P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080716
Gene: ENSMUSG00000018166
AA Change: S1181P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 2.4e-31 PFAM
FU 180 220 5.83e0 SMART
FU 223 265 7.63e-10 SMART
Pfam:Recep_L_domain 353 474 7.5e-33 PFAM
FU 490 541 7.82e-7 SMART
FU 546 595 1.34e-5 SMART
FU 607 643 9.24e0 SMART
TyrKc 707 963 7.42e-91 SMART
low complexity region 997 1018 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1135 1148 N/A INTRINSIC
low complexity region 1172 1185 N/A INTRINSIC
low complexity region 1186 1196 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131728
SMART Domains Protein: ENSMUSP00000114434
Gene: ENSMUSG00000025364

DomainStartEndE-ValueType
Pfam:Peptidase_M24 19 232 1.2e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (45/46)
MGI Phenotype Strain: 3513098; 1929072; 1928828; 1929598
Lethality: E10-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a lack of Schwann-cell precursors leading to loss of sensory and motor neurons, hypoplasia of the primary sympathetic ganglion chain, cardiac defects, impaired brain development, and embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Targeted(11) Gene trapped(14) Chemically induced(2)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 T A 17: 84,670,103 M381L probably benign Het
Abl1 T A 2: 31,779,161 L184Q probably damaging Het
Atp8b1 A G 18: 64,564,543 V410A possibly damaging Het
Bhmt2 C T 13: 93,663,314 G205R probably damaging Het
Bicd1 A G 6: 149,513,004 D405G possibly damaging Het
Brip1 A T 11: 86,152,822 probably null Het
Ccdc180 A T 4: 45,928,043 I1193F possibly damaging Het
Cdc14b A G 13: 64,205,329 C478R possibly damaging Het
Celsr1 C T 15: 85,929,872 E1950K probably benign Het
Cnot7 A G 8: 40,507,453 probably null Het
Defa34 A T 8: 21,665,867 K24I probably benign Het
Dsg4 G T 18: 20,449,712 D136Y probably damaging Het
Dync2h1 C A 9: 7,141,254 V1258F probably damaging Het
Evl A G 12: 108,686,103 D366G probably damaging Het
Fam234b A T 6: 135,225,800 probably null Het
Fanca A G 8: 123,291,395 probably null Het
Fbxo46 T A 7: 19,136,635 V393E probably damaging Het
Gkap1 T G 13: 58,263,970 K63T probably damaging Het
Hfm1 A G 5: 106,898,475 V515A possibly damaging Het
Hfm1 T A 5: 106,889,925 D742V probably benign Het
Itga10 G A 3: 96,649,582 V207I probably benign Het
Lipi T A 16: 75,560,855 Y274F probably benign Het
Mettl8 A T 2: 70,982,182 S36R probably benign Het
Miip A T 4: 147,862,564 M244K probably benign Het
Muc4 C G 16: 32,753,930 Q1269E probably benign Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nav1 T C 1: 135,471,122 N574S probably benign Het
Nlrc4 C T 17: 74,447,957 probably null Het
Oas2 C T 5: 120,745,686 W244* probably null Het
Oat A T 7: 132,566,801 I163N probably damaging Het
Olfr57 A G 10: 79,035,372 D192G probably damaging Het
Otop3 T C 11: 115,344,361 M273T possibly damaging Het
Poln A C 5: 34,133,151 V60G possibly damaging Het
Ppp1r13b G T 12: 111,833,615 A699E probably damaging Het
Rims1 A T 1: 22,805,669 M19K probably benign Het
Rnf145 T C 11: 44,531,357 L89P probably damaging Het
Rock1 A G 18: 10,140,244 S116P probably damaging Het
Rtn3 C T 19: 7,457,991 C212Y probably benign Het
Smcp G A 3: 92,584,490 P17S unknown Het
Syne2 A C 12: 75,934,499 E1525A probably damaging Het
Tpra1 A G 6: 88,910,176 D172G probably benign Het
Traf2 TAGA TA 2: 25,537,088 probably null Het
Trpa1 T C 1: 14,886,913 T760A probably benign Het
Unc13c T A 9: 73,933,168 S134C probably damaging Het
Zfp729b C T 13: 67,591,852 V765I probably benign Het
Other mutations in Erbb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Erbb3 APN 10 128570983 missense probably damaging 0.99
IGL01482:Erbb3 APN 10 128572929 missense possibly damaging 0.87
IGL01866:Erbb3 APN 10 128569368 makesense probably null
IGL01981:Erbb3 APN 10 128571650 missense probably benign 0.28
IGL02190:Erbb3 APN 10 128571010 splice site probably null
IGL02329:Erbb3 APN 10 128573219 missense probably damaging 1.00
IGL02400:Erbb3 APN 10 128579524 missense probably benign 0.02
IGL02478:Erbb3 APN 10 128571358 nonsense probably null
IGL02502:Erbb3 APN 10 128570284 missense probably benign
IGL02539:Erbb3 APN 10 128584305 splice site probably null
IGL03187:Erbb3 APN 10 128572594 splice site probably benign
I1329:Erbb3 UTSW 10 128583454 missense possibly damaging 0.73
PIT4812001:Erbb3 UTSW 10 128574379 missense possibly damaging 0.67
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0006:Erbb3 UTSW 10 128573410 critical splice donor site probably null
R0078:Erbb3 UTSW 10 128583441 missense probably damaging 1.00
R0366:Erbb3 UTSW 10 128572570 missense possibly damaging 0.77
R0601:Erbb3 UTSW 10 128577012 missense probably benign 0.01
R0621:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R1222:Erbb3 UTSW 10 128571665 missense probably damaging 1.00
R1675:Erbb3 UTSW 10 128571204 missense probably damaging 0.97
R1676:Erbb3 UTSW 10 128583248 missense probably benign 0.08
R1692:Erbb3 UTSW 10 128571725 missense probably benign 0.19
R1875:Erbb3 UTSW 10 128574466 missense possibly damaging 0.71
R2002:Erbb3 UTSW 10 128586225 missense probably benign 0.00
R2219:Erbb3 UTSW 10 128569871 missense probably damaging 0.99
R2328:Erbb3 UTSW 10 128583693 missense probably damaging 1.00
R3840:Erbb3 UTSW 10 128570324 missense probably benign
R4393:Erbb3 UTSW 10 128572770 missense probably damaging 1.00
R4567:Erbb3 UTSW 10 128579075 missense probably damaging 1.00
R4616:Erbb3 UTSW 10 128572770 nonsense probably null
R4766:Erbb3 UTSW 10 128586238 missense possibly damaging 0.76
R4881:Erbb3 UTSW 10 128576947 missense probably benign 0.00
R4974:Erbb3 UTSW 10 128572448 missense probably benign
R5266:Erbb3 UTSW 10 128569636 missense probably damaging 1.00
R5463:Erbb3 UTSW 10 128570079 nonsense probably null
R5481:Erbb3 UTSW 10 128572480 missense probably damaging 0.98
R5997:Erbb3 UTSW 10 128583185 missense probably damaging 1.00
R6370:Erbb3 UTSW 10 128570074 missense possibly damaging 0.90
R7713:Erbb3 UTSW 10 128574449 missense probably benign
R7847:Erbb3 UTSW 10 128571189 missense probably damaging 1.00
R7930:Erbb3 UTSW 10 128571189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATAGTCCTCATCTGGAGTCG -3'
(R):5'- TCCAGCGTTACCCTCAAATC -3'

Sequencing Primer
(F):5'- TCATCTGGAGTCGTGCCAG -3'
(R):5'- AGCGTTACCCTCAAATCTTCTAATC -3'
Posted On2019-10-24