Mutagenetix > Incidental Mutations

Incidental Mutation 'R7639:Muc4'

590148

Institutional Source

Beutler Lab

Gene Symbol

Muc4

Ensembl Gene

ENSMUSG00000079620

Gene Name

mucin 4

Synonyms

4933405I11Rik

Accession Numbers

Genbank: NM_080457; MGI: 2153525

Is this an essential gene?

Probably non essential (E-score: 0.110) question?

Stock #

R7639 (G1)

Quality Score

151.008

Status

Not validated

Chromosome

Chromosomal Location

32735886-32782391 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 32753930 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Glutamic Acid at position 1269 (Q1269E)

Ref Sequence

ENSEMBL: ENSMUSP00000093813 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096106] [ENSMUST00000132475]

Predicted Effect

probably benign
Transcript: ENSMUST00000096106
AA Change: Q1269E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000093813
Gene: ENSMUSG00000079620
AA Change: Q1269E

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
low complexity region	37	65	N/A	INTRINSIC
low complexity region	86	111	N/A	INTRINSIC
internal_repeat_2	119	903	6.07e-127	PROSPERO
internal_repeat_1	164	987	3.47e-144	PROSPERO
internal_repeat_2	979	1875	6.07e-127	PROSPERO
internal_repeat_1	1193	2087	3.47e-144	PROSPERO
low complexity region	2090	2106	N/A	INTRINSIC
low complexity region	2111	2119	N/A	INTRINSIC
low complexity region	2186	2195	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2324	2332	N/A	INTRINSIC
low complexity region	2344	2367	N/A	INTRINSIC
NIDO	2458	2615	8.33e-67	SMART
AMOP	2614	2726	1.29e-47	SMART
VWD	2729	2910	4.23e-26	SMART
EGF_like	3134	3166	3.23e1	SMART
EGF_like	3176	3212	3.5e1	SMART
low complexity region	3237	3251	N/A	INTRINSIC
EGF	3384	3421	1.4e0	SMART
transmembrane domain	3430	3452	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132475

SMART Domains

Protein: ENSMUSP00000119029
Gene: ENSMUSG00000079620

Domain	Start	End	E-Value	Type
low complexity region	38	45	N/A	INTRINSIC
low complexity region	72	84	N/A	INTRINSIC
low complexity region	99	127	N/A	INTRINSIC
low complexity region	148	173	N/A	INTRINSIC
low complexity region	192	224	N/A	INTRINSIC
low complexity region	283	293	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135753

SMART Domains

Protein: ENSMUSP00000119154
Gene: ENSMUSG00000079620

Domain	Start	End	E-Value	Type
low complexity region	21	37	N/A	INTRINSIC
low complexity region	42	50	N/A	INTRINSIC
low complexity region	117	126	N/A	INTRINSIC
low complexity region	161	180	N/A	INTRINSIC
low complexity region	255	263	N/A	INTRINSIC
low complexity region	275	298	N/A	INTRINSIC
NIDO	389	546	8.33e-67	SMART
AMOP	545	657	1.29e-47	SMART
VWD	660	841	4.23e-26	SMART
EGF_like	1065	1097	3.23e1	SMART
EGF_like	1107	1143	3.5e1	SMART
low complexity region	1168	1182	N/A	INTRINSIC
EGF	1315	1352	1.4e0	SMART
transmembrane domain	1361	1383	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface. A large 5' exon encodes at least 15 tandem repeats of 124-126 amino acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to DSS-treated colitis and colitis-associated colorectal cancer. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg5	T	A	17: 84,670,103	M381L	probably benign	Het
Abl1	T	A	2: 31,779,161	L184Q	probably damaging	Het
Atp8b1	A	G	18: 64,564,543	V410A	possibly damaging	Het
Bhmt2	C	T	13: 93,663,314	G205R	probably damaging	Het
Bicd1	A	G	6: 149,513,004	D405G	possibly damaging	Het
Ccdc180	A	T	4: 45,928,043	I1193F	possibly damaging	Het
Cdc14b	A	G	13: 64,205,329	C478R	possibly damaging	Het
Celsr1	C	T	15: 85,929,872	E1950K	probably benign	Het
Cnot7	A	G	8: 40,507,453		probably null	Het
Defa34	A	T	8: 21,665,867	K24I	probably benign	Het
Dsg4	G	T	18: 20,449,712	D136Y	probably damaging	Het
Dync2h1	C	A	9: 7,141,254	V1258F	probably damaging	Het
Erbb3	A	G	10: 128,569,847	S1181P	probably damaging	Het
Evl	A	G	12: 108,686,103	D366G	probably damaging	Het
Fanca	A	G	8: 123,291,395		probably null	Het
Fbxo46	T	A	7: 19,136,635	V393E	probably damaging	Het
Gkap1	T	G	13: 58,263,970	K63T	probably damaging	Het
Hfm1	T	A	5: 106,889,925	D742V	probably benign	Het
Hfm1	A	G	5: 106,898,475	V515A	possibly damaging	Het
Itga10	G	A	3: 96,649,582	V207I	probably benign	Het
Lipi	T	A	16: 75,560,855	Y274F	probably benign	Het
Mettl8	A	T	2: 70,982,182	S36R	probably benign	Het
Miip	A	T	4: 147,862,564	M244K	probably benign	Het
Nat10	G	A	2: 103,743,090	A354V	probably damaging	Het
Nav1	T	C	1: 135,471,122	N574S	probably benign	Het
Nlrc4	C	T	17: 74,447,957		probably null	Het
Oas2	C	T	5: 120,745,686	W244*	probably null	Het
Oat	A	T	7: 132,566,801	I163N	probably damaging	Het
Olfr57	A	G	10: 79,035,372	D192G	probably damaging	Het
Otop3	T	C	11: 115,344,361	M273T	possibly damaging	Het
Poln	A	C	5: 34,133,151	V60G	possibly damaging	Het
Ppp1r13b	G	T	12: 111,833,615	A699E	probably damaging	Het
Rims1	A	T	1: 22,805,669	M19K	probably benign	Het
Rnf145	T	C	11: 44,531,357	L89P	probably damaging	Het
Rock1	A	G	18: 10,140,244	S116P	probably damaging	Het
Rtn3	C	T	19: 7,457,991	C212Y	probably benign	Het
Smcp	G	A	3: 92,584,490	P17S	unknown	Het
Syne2	A	C	12: 75,934,499	E1525A	probably damaging	Het
Tpra1	A	G	6: 88,910,176	D172G	probably benign	Het
Traf2	TAGA	TA	2: 25,537,088		probably null	Het
Trpa1	T	C	1: 14,886,913	T760A	probably benign	Het
Unc13c	T	A	9: 73,933,168	S134C	probably damaging	Het
Zfp729b	C	T	13: 67,591,852	V765I	probably benign	Het

Other mutations in Muc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00088:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00089:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00090:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00091:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00092:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00163:Muc4	APN	16	32754090	missense	probably benign	0.20
IGL00324:Muc4	APN	16	32778812	missense	probably benign	0.03
IGL00331:Muc4	APN	16	32753185	missense	probably benign	0.01
IGL00539:Muc4	APN	16	32750910	missense	possibly damaging	0.53
IGL00590:Muc4	APN	16	32754347	missense	probably benign	0.10
IGL00990:Muc4	APN	16	32753955	missense	possibly damaging	0.86
IGL00990:Muc4	APN	16	32755805	unclassified	probably benign
IGL00990:Muc4	APN	16	32753823	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32753848	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32753849	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32753863	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32753886	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32752569	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32754071	missense	probably benign	0.01
IGL01091:Muc4	APN	16	32753927	missense	probably benign	0.04
IGL01124:Muc4	APN	16	32768730	missense	possibly damaging	0.65
IGL01131:Muc4	APN	16	32753901	missense	possibly damaging	0.72
IGL01536:Muc4	APN	16	32763966	missense	possibly damaging	0.93
IGL01603:Muc4	APN	16	32750655	missense	probably benign	0.23
IGL01618:Muc4	APN	16	32756627	missense	unknown
IGL01625:Muc4	APN	16	32755544	unclassified	probably benign
IGL01626:Muc4	APN	16	32736402	missense	possibly damaging	0.48
IGL01653:Muc4	APN	16	32761348	splice site	probably null
IGL01682:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL01870:Muc4	APN	16	32753196	missense	probably benign	0.01
IGL01966:Muc4	APN	16	32751426	missense	possibly damaging	0.84
IGL01973:Muc4	APN	16	32754265	missense	probably benign	0.01
IGL02089:Muc4	APN	16	32751313	missense	possibly damaging	0.83
IGL02152:Muc4	APN	16	32777649	splice site	probably benign
IGL02210:Muc4	APN	16	32752254	missense	probably benign	0.00
IGL02278:Muc4	APN	16	32754529	missense	probably benign	0.01
IGL02280:Muc4	APN	16	32754529	missense	probably benign	0.01
IGL02316:Muc4	APN	16	32750850	missense	possibly damaging	0.73
IGL02351:Muc4	APN	16	32750986	missense	possibly damaging	0.86
IGL02358:Muc4	APN	16	32750986	missense	possibly damaging	0.86
IGL02391:Muc4	APN	16	32752076	missense	probably benign	0.41
IGL02449:Muc4	APN	16	32756129	unclassified	probably benign
IGL02607:Muc4	APN	16	32775819	missense	possibly damaging	0.73
IGL02888:Muc4	APN	16	32755282	unclassified	probably benign
IGL02893:Muc4	APN	16	32751648	missense	possibly damaging	0.68
IGL02902:Muc4	APN	16	32750394	missense	possibly damaging	0.50
IGL03007:Muc4	APN	16	32752048	missense	possibly damaging	0.84
IGL03161:Muc4	APN	16	32751948	missense	possibly damaging	0.84
IGL03304:Muc4	APN	16	32751439	nonsense	probably null
IGL03335:Muc4	APN	16	32753021	missense	probably benign	0.01
IGL03411:Muc4	APN	16	32754318	missense	probably benign	0.01
3-1:Muc4	UTSW	16	32760251	splice site	probably benign
3-1:Muc4	UTSW	16	32770394	missense	possibly damaging	0.86
IGL02835:Muc4	UTSW	16	32763945	missense	probably benign	0.32
P0035:Muc4	UTSW	16	32760248	splice site	probably benign
PIT4131001:Muc4	UTSW	16	32755676	unclassified	probably benign
PIT4131001:Muc4	UTSW	16	32755684	unclassified	probably benign
PIT4131001:Muc4	UTSW	16	32755699	unclassified	probably benign
PIT4142001:Muc4	UTSW	16	32754529	missense	probably benign	0.01
PIT4142001:Muc4	UTSW	16	32755676	unclassified	probably benign
PIT4142001:Muc4	UTSW	16	32755684	unclassified	probably benign
PIT4366001:Muc4	UTSW	16	32754796	missense	unknown
PIT4531001:Muc4	UTSW	16	32756017	missense	unknown
R0119:Muc4	UTSW	16	32750195	critical splice acceptor site	probably benign
R0133:Muc4	UTSW	16	32771604	missense	possibly damaging	0.91
R0136:Muc4	UTSW	16	32750195	critical splice acceptor site	probably benign
R0243:Muc4	UTSW	16	32765746	missense	possibly damaging	0.53
R0277:Muc4	UTSW	16	32755690	unclassified	probably benign
R0299:Muc4	UTSW	16	32750195	critical splice acceptor site	probably benign
R0380:Muc4	UTSW	16	32752905	missense	probably benign	0.00
R0462:Muc4	UTSW	16	32762536	missense	possibly damaging	0.93
R0507:Muc4	UTSW	16	32751069	missense	probably benign	0.01
R0508:Muc4	UTSW	16	32751313	missense	possibly damaging	0.83
R0543:Muc4	UTSW	16	32756746	missense	unknown
R0578:Muc4	UTSW	16	32755690	unclassified	probably benign
R0617:Muc4	UTSW	16	32752107	missense	possibly damaging	0.83
R0656:Muc4	UTSW	16	32751670	missense	possibly damaging	0.91
R0726:Muc4	UTSW	16	32769827	missense	probably damaging	0.99
R0727:Muc4	UTSW	16	32769847	missense	probably benign	0.01
R0776:Muc4	UTSW	16	32752220	missense	probably benign	0.04
R0854:Muc4	UTSW	16	32778955	missense	possibly damaging	0.53
R0862:Muc4	UTSW	16	32752002	missense	probably benign	0.01
R0864:Muc4	UTSW	16	32752002	missense	probably benign	0.01
R0926:Muc4	UTSW	16	32756196	unclassified	probably benign
R0990:Muc4	UTSW	16	32752722	missense	probably benign	0.00
R1127:Muc4	UTSW	16	32750525	missense	possibly damaging	0.92
R1203:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R1433:Muc4	UTSW	16	32753020	missense	probably benign	0.00
R1466:Muc4	UTSW	16	32753595	missense	probably benign	0.04
R1466:Muc4	UTSW	16	32753595	missense	probably benign	0.04
R1506:Muc4	UTSW	16	32752233	missense	possibly damaging	0.59
R1518:Muc4	UTSW	16	32750349	missense	possibly damaging	0.84
R1544:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R1584:Muc4	UTSW	16	32753595	missense	probably benign	0.04
R1593:Muc4	UTSW	16	32754686	missense	probably benign	0.00
R1601:Muc4	UTSW	16	32755501	unclassified	probably benign
R1611:Muc4	UTSW	16	32750986	missense	possibly damaging	0.86
R1673:Muc4	UTSW	16	32756902	missense	probably benign	0.11
R1717:Muc4	UTSW	16	32753405	missense	possibly damaging	0.53
R1822:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R1824:Muc4	UTSW	16	32755933	unclassified	probably benign
R1839:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R1846:Muc4	UTSW	16	32752369	missense	probably benign	0.01
R1864:Muc4	UTSW	16	32756251	unclassified	probably benign
R1868:Muc4	UTSW	16	32756341	missense	unknown
R1928:Muc4	UTSW	16	32750532	missense	probably damaging	0.99
R1942:Muc4	UTSW	16	32750642	missense	probably damaging	0.99
R2017:Muc4	UTSW	16	32751303	missense	possibly damaging	0.92
R2023:Muc4	UTSW	16	32752254	missense	probably benign	0.00
R2081:Muc4	UTSW	16	32752220	missense	probably benign	0.04
R2088:Muc4	UTSW	16	32756409	missense	unknown
R2121:Muc4	UTSW	16	32760238	missense	unknown
R2139:Muc4	UTSW	16	32761225	missense	unknown
R2158:Muc4	UTSW	16	32754563	missense	probably benign	0.10
R2165:Muc4	UTSW	16	32750476	missense	probably damaging	0.96
R2210:Muc4	UTSW	16	32755176	frame shift	probably null
R2225:Muc4	UTSW	16	32755891	unclassified	probably benign
R2225:Muc4	UTSW	16	32766942	missense	possibly damaging	0.73
R2269:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R2679:Muc4	UTSW	16	32757472	missense	unknown
R3703:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R3816:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R3909:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R4014:Muc4	UTSW	16	32755273	unclassified	probably benign
R4065:Muc4	UTSW	16	32751051	missense	possibly damaging	0.53
R4066:Muc4	UTSW	16	32751051	missense	possibly damaging	0.53
R4067:Muc4	UTSW	16	32751051	missense	possibly damaging	0.53
R4245:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4249:Muc4	UTSW	16	32755826	unclassified	probably benign
R4344:Muc4	UTSW	16	32770292	missense	possibly damaging	0.53
R4388:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4393:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R4482:Muc4	UTSW	16	32756701	missense	unknown
R4523:Muc4	UTSW	16	32736336	utr 5 prime	probably benign
R4527:Muc4	UTSW	16	32755843	unclassified	probably benign
R4572:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4587:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R4614:Muc4	UTSW	16	32757058	missense	probably benign	0.03
R4635:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4661:Muc4	UTSW	16	32769277	missense	possibly damaging	0.71
R4701:Muc4	UTSW	16	32755846	unclassified	probably benign
R4730:Muc4	UTSW	16	32751214	missense	possibly damaging	0.86
R4740:Muc4	UTSW	16	32775903	missense	possibly damaging	0.91
R4762:Muc4	UTSW	16	32753625	unclassified	probably benign
R4818:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R4821:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4825:Muc4	UTSW	16	32751747	missense	probably benign	0.41
R4830:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R4860:Muc4	UTSW	16	32754616	missense	probably benign	0.35
R4860:Muc4	UTSW	16	32754625	missense	probably benign	0.18
R4869:Muc4	UTSW	16	32754836	unclassified	probably benign
R4934:Muc4	UTSW	16	32756098	unclassified	probably benign
R4959:Muc4	UTSW	16	32754319	missense	possibly damaging	0.73
R4969:Muc4	UTSW	16	32754572	missense	probably benign	0.01
R4995:Muc4	UTSW	16	32754214	missense	probably benign	0.01
R4995:Muc4	UTSW	16	32754041	missense	probably benign	0.01
R4999:Muc4	UTSW	16	32756296	unclassified	probably benign
R5073:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R5075:Muc4	UTSW	16	32754794	unclassified	probably benign
R5152:Muc4	UTSW	16	32757058	nonsense	probably null
R5161:Muc4	UTSW	16	32762521	missense	probably damaging	0.98
R5174:Muc4	UTSW	16	32751738	missense	possibly damaging	0.84
R5268:Muc4	UTSW	16	32751666	missense	possibly damaging	0.83
R5447:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R5474:Muc4	UTSW	16	32761261	missense	unknown
R5567:Muc4	UTSW	16	32777692	missense	possibly damaging	0.72
R5570:Muc4	UTSW	16	32777692	missense	possibly damaging	0.72
R5618:Muc4	UTSW	16	32754253	missense	probably benign	0.01
R5665:Muc4	UTSW	16	32750782	missense	probably benign	0.33
R5667:Muc4	UTSW	16	32753720	missense	probably benign	0.01
R5671:Muc4	UTSW	16	32753720	missense	probably benign	0.01
R5693:Muc4	UTSW	16	32776807	missense	possibly damaging	0.53
R5703:Muc4	UTSW	16	32736241	nonsense	probably null
R5708:Muc4	UTSW	16	32754769	unclassified	probably benign
R5715:Muc4	UTSW	16	32751916	missense	possibly damaging	0.92
R5849:Muc4	UTSW	16	32774839	missense	possibly damaging	0.53
R5873:Muc4	UTSW	16	32751295	missense	possibly damaging	0.61
R5930:Muc4	UTSW	16	32751705	missense	probably benign	0.41
R5933:Muc4	UTSW	16	32753052	missense	probably benign	0.01
R5966:Muc4	UTSW	16	32756278	unclassified	probably benign
R6062:Muc4	UTSW	16	32759308	missense	unknown
R6067:Muc4	UTSW	16	32755247	unclassified	probably benign
R6067:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R6078:Muc4	UTSW	16	32755247	unclassified	probably benign
R6079:Muc4	UTSW	16	32755247	unclassified	probably benign
R6112:Muc4	UTSW	16	32775783	missense	possibly damaging	0.86
R6120:Muc4	UTSW	16	32756795	missense	unknown
R6144:Muc4	UTSW	16	32766924	missense	possibly damaging	0.53
R6148:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R6173:Muc4	UTSW	16	32736140	start gained	probably benign
R6268:Muc4	UTSW	16	32768767	missense	probably damaging	0.99
R6299:Muc4	UTSW	16	32752035	missense	possibly damaging	0.48
R6307:Muc4	UTSW	16	32753946	missense	possibly damaging	0.56
R6354:Muc4	UTSW	16	32754358	missense	probably benign	0.19
R6361:Muc4	UTSW	16	32767351	missense	probably benign	0.32
R6375:Muc4	UTSW	16	32736243	utr 5 prime	probably benign
R6378:Muc4	UTSW	16	32778946	missense	probably benign	0.33
R6418:Muc4	UTSW	16	32751789	missense	possibly damaging	0.68
R6458:Muc4	UTSW	16	32759320	critical splice donor site	probably null
R6527:Muc4	UTSW	16	32753433	missense	probably benign	0.01
R6616:Muc4	UTSW	16	32782008	missense	possibly damaging	0.93
R6636:Muc4	UTSW	16	32753964	missense	probably benign	0.01
R6637:Muc4	UTSW	16	32753964	missense	probably benign	0.01
R6915:Muc4	UTSW	16	32766938	missense	probably benign	0.18
R6947:Muc4	UTSW	16	32775803	missense	possibly damaging	0.91
R6976:Muc4	UTSW	16	32762518	missense	possibly damaging	0.92
R6985:Muc4	UTSW	16	32751999	missense	probably benign	0.00
R7020:Muc4	UTSW	16	32751810	nonsense	probably null
R7033:Muc4	UTSW	16	32756324	unclassified	probably benign
R7098:Muc4	UTSW	16	32757091	missense
R7123:Muc4	UTSW	16	32750691	missense	possibly damaging	0.83
R7173:Muc4	UTSW	16	32762488	missense	probably damaging	0.97
R7178:Muc4	UTSW	16	32752788	missense	unknown
R7294:Muc4	UTSW	16	32756461	missense	possibly damaging	0.53
R7318:Muc4	UTSW	16	32755336	missense	unknown
R7361:Muc4	UTSW	16	32754670	missense	probably benign	0.18
R7380:Muc4	UTSW	16	32755366	missense	unknown
R7381:Muc4	UTSW	16	32780915	missense
R7411:Muc4	UTSW	16	32751322	missense	probably benign	0.12
R7422:Muc4	UTSW	16	32754689	missense	probably benign	0.00
R7482:Muc4	UTSW	16	32766950	missense
R7539:Muc4	UTSW	16	32756396	missense
R7544:Muc4	UTSW	16	32736198	start codon destroyed	probably null
R7574:Muc4	UTSW	16	32753411	missense	probably benign	0.18
R7576:Muc4	UTSW	16	32754500	missense	probably benign	0.10
R7585:Muc4	UTSW	16	32765702	missense
R7594:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7595:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7596:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7597:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7601:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7602:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7616:Muc4	UTSW	16	32752361	nonsense	probably null
R7640:Muc4	UTSW	16	32760105	missense
R7651:Muc4	UTSW	16	32756575	missense
R7688:Muc4	UTSW	16	32751460	missense	possibly damaging	0.68
R7689:Muc4	UTSW	16	32753011	missense	probably benign	0.10
R7752:Muc4	UTSW	16	32768734	missense
R7763:Muc4	UTSW	16	32753311	missense	probably benign	0.10
R7768:Muc4	UTSW	16	32756194	missense	unknown
R7787:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7789:Muc4	UTSW	16	32753930	missense	probably benign	0.01
RF014:Muc4	UTSW	16	32751858	missense	probably damaging	0.98
U15987:Muc4	UTSW	16	32754529	missense	probably benign	0.01
U15987:Muc4	UTSW	16	32755247	unclassified	probably benign
V5622:Muc4	UTSW	16	32751825	missense	probably benign	0.00
X0018:Muc4	UTSW	16	32755481	unclassified	probably benign
X0028:Muc4	UTSW	16	32759319	critical splice donor site	probably null
Z1088:Muc4	UTSW	16	32756076	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCCAGAACATGTCAACAGTG -3'
(R):5'- CTCATGAGGGAGCATGTGAG -3'

Sequencing Primer
(F):5'- GAACATGTCAACAGTGTCAGC -3'
(R):5'- TTCTGGGAGGAAGGTGAGACC -3'

Posted On

2019-10-24