Mutagenetix > Incidental Mutation

Incidental Mutation 'R7640:Sphkap'

590156

Institutional Source

Beutler Lab

Gene Symbol

Sphkap

Ensembl Gene

ENSMUSG00000026163

Gene Name

SPHK1 interactor, AKAP domain containing

Synonyms

4930544G21Rik, A930009L15Rik, SKIP

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R7640 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83254139-83408200 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83278928 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 367 (D367N)

Ref Sequence

ENSEMBL: ENSMUSP00000124872 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159078] [ENSMUST00000160953]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159078
AA Change: D80N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124384
Gene: ENSMUSG00000026163
AA Change: D80N

Domain	Start	End	E-Value	Type
low complexity region	303	314	N/A	INTRINSIC
SCOP:d1ash__	382	462	5e-3	SMART
low complexity region	809	819	N/A	INTRINSIC
low complexity region	854	865	N/A	INTRINSIC
low complexity region	1202	1221	N/A	INTRINSIC
low complexity region	1243	1254	N/A	INTRINSIC
Pfam:AKAP_110	1281	1398	7.5e-13	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160953
AA Change: D367N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000124872
Gene: ENSMUSG00000026163
AA Change: D367N

Domain	Start	End	E-Value	Type
low complexity region	590	601	N/A	INTRINSIC
SCOP:d1ash__	669	749	6e-3	SMART
low complexity region	1096	1106	N/A	INTRINSIC
low complexity region	1141	1152	N/A	INTRINSIC
low complexity region	1489	1508	N/A	INTRINSIC
Pfam:AKAP_110	1540	1655	6.4e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (68/69)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	A	T	4: 137,454,594	N20I	probably damaging	Het
1700020D05Rik	T	A	19: 5,503,007	S249C	probably damaging	Het
4930558K02Rik	A	G	1: 161,957,149	S74P	probably benign	Het
4932415D10Rik	T	A	10: 82,294,656	N840I	probably damaging	Het
Abcb6	A	T	1: 75,174,845		probably null	Het
Adamts14	C	A	10: 61,246,057	A234S	probably benign	Het
Ankrd42	A	G	7: 92,619,635	S167P	probably benign	Het
Ap3m1	T	C	14: 21,038,175	I272V	probably benign	Het
Armt1	T	C	10: 4,453,572	F219S	probably damaging	Het
Atr	T	G	9: 95,907,293		probably null	Het
Cep72	G	A	13: 74,058,488	Q72*	probably null	Het
Clock	G	T	5: 76,248,378	L175M	possibly damaging	Het
Cnmd	T	A	14: 79,661,534	Y26F	possibly damaging	Het
Col6a6	A	T	9: 105,785,744	M198K	possibly damaging	Het
Cuta	C	T	17: 26,938,422	V135I	probably benign	Het
Ddx41	A	T	13: 55,534,239	M241K	possibly damaging	Het
Dnajc22	A	G	15: 99,101,114	N60S	probably damaging	Het
Drc3	A	G	11: 60,388,904	M432V	probably benign	Het
Eef1d	C	A	15: 75,902,707	G368C	probably damaging	Het
En2	A	T	5: 28,170,166	K236*	probably null	Het
Fas	A	G	19: 34,307,164	T24A	possibly damaging	Het
Gm13078	T	C	4: 143,726,706	V128A	probably benign	Het
Golga2	T	C	2: 32,306,239	V930A	probably benign	Het
Gprin2	G	T	14: 34,195,753	A20D	probably benign	Het
Ighv14-4	A	T	12: 114,176,444	C115*	probably null	Het
Impdh2	T	C	9: 108,565,181	Y459H	possibly damaging	Het
Klhdc7b	G	T	15: 89,387,260	V124L	possibly damaging	Het
L2hgdh	A	T	12: 69,721,357	Y122*	probably null	Het
Lamc2	A	T	1: 153,136,804	I708N	possibly damaging	Het
Large2	T	C	2: 92,374,705	M1V	probably null	Het
Lrit2	T	C	14: 37,072,124	W382R	probably damaging	Het
Mcee	T	A	7: 64,411,968	V173E	probably damaging	Het
Mcph1	T	A	8: 18,632,326	V493E	probably benign	Het
Mfap4	A	G	11: 61,487,087	N118D	probably damaging	Het
Mknk2	T	C	10: 80,668,566	S301G	probably benign	Het
Mlf1	G	A	3: 67,392,933	M94I	possibly damaging	Het
Mrc2	T	A	11: 105,332,295	S455T	possibly damaging	Het
Mrgprb5	T	G	7: 48,168,259	I243L	probably benign	Het
Muc4	C	A	16: 32,760,105	P360T		Het
Nat10	G	A	2: 103,743,090	A354V	probably damaging	Het
Nts	T	C	10: 102,490,304	Q7R	possibly damaging	Het
Oas1b	T	C	5: 120,821,414	L288P	probably damaging	Het
Olfr1076	A	G	2: 86,508,943	I161M	possibly damaging	Het
Olfr1131	A	G	2: 87,629,092	I94V	probably benign	Het
Olfr1196	T	A	2: 88,700,886	I148L	probably benign	Het
Olfr633	A	T	7: 103,946,943	I126F	probably damaging	Het
Otoa	A	G	7: 121,145,626	E869G	probably damaging	Het
Pcdhac2	T	C	18: 37,144,525	L186P	probably damaging	Het
Plekhh2	A	G	17: 84,610,776	E1271G	possibly damaging	Het
Pmepa1	C	T	2: 173,276,163	A8T	probably benign	Het
Rc3h2	A	G	2: 37,377,849		probably null	Het
Rlf	T	A	4: 121,146,801	M1771L	possibly damaging	Het
Rpap1	G	A	2: 119,764,410	P1372L	possibly damaging	Het
Rragd	A	T	4: 32,983,527	D22V	probably benign	Het
Sema3f	A	T	9: 107,683,575	S644R	probably benign	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Specc1l	T	A	10: 75,257,869	N717K	probably damaging	Het
Tbc1d21	C	T	9: 58,361,261	V272M	probably damaging	Het
Tmem132c	A	G	5: 127,563,006	D747G	probably damaging	Het
Tmem56	A	G	3: 121,235,041		probably null	Het
Trim2	C	A	3: 84,190,906	V372F	probably benign	Het
Ttc34	A	G	4: 154,861,384	T292A	probably benign	Het
Ube3b	A	G	5: 114,415,323	T919A	probably benign	Het
Wdr34	T	G	2: 30,031,768	D527A	probably benign	Het
Zfhx4	T	C	3: 5,412,480	I3385T	probably benign	Het
Zfp423	T	C	8: 87,781,277	K813R	probably damaging	Het
Zfp850	T	C	7: 27,989,209	T525A	probably benign	Het
Zfp873	T	C	10: 82,060,275	I280T	possibly damaging	Het
Zkscan7	A	G	9: 122,896,056	T697A	possibly damaging	Het

Other mutations in Sphkap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Sphkap	APN	1	83280516	missense	probably damaging	1.00
IGL00337:Sphkap	APN	1	83339608	missense	probably damaging	1.00
IGL00470:Sphkap	APN	1	83277910	missense	possibly damaging	0.87
IGL00577:Sphkap	APN	1	83278844	missense	probably damaging	1.00
IGL00657:Sphkap	APN	1	83276375	missense	probably damaging	1.00
IGL01868:Sphkap	APN	1	83280399	splice site	probably null
IGL02101:Sphkap	APN	1	83290987	missense	probably damaging	1.00
IGL02471:Sphkap	APN	1	83276176	missense	probably damaging	1.00
IGL02943:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL02945:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03008:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03031:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03059:Sphkap	APN	1	83257242	missense	probably damaging	0.97
IGL03085:Sphkap	APN	1	83280354	missense	possibly damaging	0.92
IGL03355:Sphkap	APN	1	83280503	missense	probably damaging	1.00
IGL03356:Sphkap	APN	1	83276831	missense	probably damaging	1.00
IGL03368:Sphkap	APN	1	83275676	missense	probably benign	0.14
R0294:Sphkap	UTSW	1	83278245	missense	possibly damaging	0.72
R0308:Sphkap	UTSW	1	83276969	missense	probably damaging	1.00
R0478:Sphkap	UTSW	1	83278711	missense	probably damaging	1.00
R0606:Sphkap	UTSW	1	83280424	missense	probably damaging	1.00
R0678:Sphkap	UTSW	1	83278628	missense	probably benign	0.03
R1216:Sphkap	UTSW	1	83290977	missense	probably damaging	1.00
R1253:Sphkap	UTSW	1	83278898	missense	possibly damaging	0.56
R1532:Sphkap	UTSW	1	83257203	missense	probably damaging	1.00
R1635:Sphkap	UTSW	1	83278400	missense	probably benign	0.03
R1655:Sphkap	UTSW	1	83277515	nonsense	probably null
R1657:Sphkap	UTSW	1	83277515	nonsense	probably null
R1700:Sphkap	UTSW	1	83277515	nonsense	probably null
R1701:Sphkap	UTSW	1	83277515	nonsense	probably null
R1734:Sphkap	UTSW	1	83277515	nonsense	probably null
R1736:Sphkap	UTSW	1	83277515	nonsense	probably null
R1743:Sphkap	UTSW	1	83277515	nonsense	probably null
R1744:Sphkap	UTSW	1	83277515	nonsense	probably null
R1760:Sphkap	UTSW	1	83277544	missense	probably benign	0.29
R1893:Sphkap	UTSW	1	83278966	missense	probably benign	0.02
R1937:Sphkap	UTSW	1	83267441	nonsense	probably null
R1986:Sphkap	UTSW	1	83277922	missense	probably damaging	1.00
R1993:Sphkap	UTSW	1	83277515	nonsense	probably null
R1995:Sphkap	UTSW	1	83277515	nonsense	probably null
R2001:Sphkap	UTSW	1	83276662	missense	probably damaging	1.00
R2004:Sphkap	UTSW	1	83277911	missense	probably benign	0.04
R2111:Sphkap	UTSW	1	83275881	missense	probably benign	0.00
R2112:Sphkap	UTSW	1	83275881	missense	probably benign	0.00
R2156:Sphkap	UTSW	1	83277989	missense	probably benign	0.03
R2182:Sphkap	UTSW	1	83276684	missense	probably damaging	1.00
R2271:Sphkap	UTSW	1	83257221	missense	probably damaging	1.00
R3712:Sphkap	UTSW	1	83277112	missense	probably benign	0.27
R3919:Sphkap	UTSW	1	83276458	missense	probably damaging	1.00
R3980:Sphkap	UTSW	1	83267494	splice site	probably null
R4130:Sphkap	UTSW	1	83277898	missense	probably damaging	0.96
R4539:Sphkap	UTSW	1	83277793	missense	probably benign	0.00
R4602:Sphkap	UTSW	1	83279061	nonsense	probably null
R4735:Sphkap	UTSW	1	83279117	missense	probably benign	0.01
R4793:Sphkap	UTSW	1	83278084	missense	possibly damaging	0.77
R4849:Sphkap	UTSW	1	83277384	missense	probably benign	0.03
R4880:Sphkap	UTSW	1	83288817	missense	probably damaging	1.00
R5213:Sphkap	UTSW	1	83280503	missense	probably damaging	1.00
R5277:Sphkap	UTSW	1	83276164	missense	probably benign	0.04
R5331:Sphkap	UTSW	1	83276782	missense	probably benign	0.08
R5632:Sphkap	UTSW	1	83278285	missense	probably benign	0.01
R5647:Sphkap	UTSW	1	83407999	missense	probably damaging	0.98
R5751:Sphkap	UTSW	1	83275897	missense	probably benign	0.27
R5935:Sphkap	UTSW	1	83339599	missense	probably damaging	1.00
R5999:Sphkap	UTSW	1	83267405	missense	probably benign	0.02
R6232:Sphkap	UTSW	1	83280479	missense	probably damaging	1.00
R6318:Sphkap	UTSW	1	83278378	missense	probably damaging	1.00
R6474:Sphkap	UTSW	1	83278823	missense	probably damaging	1.00
R6602:Sphkap	UTSW	1	83275758	missense	possibly damaging	0.75
R6674:Sphkap	UTSW	1	83277834	missense	probably benign	0.37
R6716:Sphkap	UTSW	1	83362228	critical splice donor site	probably null
R6803:Sphkap	UTSW	1	83280510	missense	probably damaging	1.00
R6880:Sphkap	UTSW	1	83257257	missense	probably damaging	1.00
R6941:Sphkap	UTSW	1	83408090	start gained	probably benign
R7170:Sphkap	UTSW	1	83265985	missense	probably damaging	0.99
R7263:Sphkap	UTSW	1	83276678	missense	probably damaging	1.00
R7422:Sphkap	UTSW	1	83263826	missense	probably benign	0.02
R7722:Sphkap	UTSW	1	83278921	missense	probably benign	0.00
R7810:Sphkap	UTSW	1	83276300	missense	probably damaging	1.00
R7887:Sphkap	UTSW	1	83277412	missense	probably benign	0.00
R7974:Sphkap	UTSW	1	83278962	missense	probably damaging	1.00
R7990:Sphkap	UTSW	1	83267345	missense	probably damaging	0.99
R8096:Sphkap	UTSW	1	83277558	missense	probably damaging	0.98
R8110:Sphkap	UTSW	1	83278771	missense	possibly damaging	0.82
R8125:Sphkap	UTSW	1	83263582	missense	probably damaging	1.00
R8153:Sphkap	UTSW	1	83278009	missense	possibly damaging	0.93
R8245:Sphkap	UTSW	1	83278771	missense	probably benign	0.14
R8394:Sphkap	UTSW	1	83276076	missense	probably benign	0.08
R8443:Sphkap	UTSW	1	83278232	missense	probably benign	0.00
R8508:Sphkap	UTSW	1	83276500	missense	probably damaging	1.00
R8531:Sphkap	UTSW	1	83277188	missense	probably damaging	1.00
R8673:Sphkap	UTSW	1	83275840	missense	probably benign	0.01
R8674:Sphkap	UTSW	1	83277844	missense	probably benign	0.04
R8682:Sphkap	UTSW	1	83279276	missense	probably benign	0.21
R8837:Sphkap	UTSW	1	83275663	missense	possibly damaging	0.87
R8857:Sphkap	UTSW	1	83280567	missense	probably damaging	1.00
R8902:Sphkap	UTSW	1	83278964	missense	probably benign	0.21
R8916:Sphkap	UTSW	1	83277387	missense	possibly damaging	0.87
R8944:Sphkap	UTSW	1	83279206	missense	probably benign	0.39
R9154:Sphkap	UTSW	1	83257261	missense	probably damaging	1.00
R9579:Sphkap	UTSW	1	83277574	missense	probably damaging	0.99
R9616:Sphkap	UTSW	1	83277268	missense	probably damaging	1.00
R9781:Sphkap	UTSW	1	83278051	missense	possibly damaging	0.62
Z1088:Sphkap	UTSW	1	83276608	missense	probably damaging	1.00
Z1088:Sphkap	UTSW	1	83278604	missense	probably damaging	1.00
Z1176:Sphkap	UTSW	1	83276033	nonsense	probably null
Z1176:Sphkap	UTSW	1	83280442	missense	possibly damaging	0.61
Z1177:Sphkap	UTSW	1	83276431	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ATATCTTTTGTGCAACAGCCAC -3'
(R):5'- GGCCATCACACCTGAAAAGTG -3'

Sequencing Primer
(F):5'- CCACTGGGAAGGAGAGCACTTC -3'
(R):5'- CCATCACACCTGAAAAGTGAAGTGG -3'

Posted On

2019-10-24