Incidental Mutation 'R7640:Lamc2'
ID 590158
Institutional Source Beutler Lab
Gene Symbol Lamc2
Ensembl Gene ENSMUSG00000026479
Gene Name laminin, gamma 2
Synonyms nicein, 100kDa
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.460) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 152998502-153062193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 153012550 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 708 (I708N)
Ref Sequence ENSEMBL: ENSMUSP00000140514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000185356]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000027753
AA Change: I708N

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: I708N

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000185356
AA Change: I708N

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: I708N

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Atr T G 9: 95,789,346 (GRCm39) probably null Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Clock G T 5: 76,396,225 (GRCm39) L175M possibly damaging Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Cuta C T 17: 27,157,396 (GRCm39) V135I probably benign Het
Ddx41 A T 13: 55,682,052 (GRCm39) M241K possibly damaging Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Fas A G 19: 34,284,564 (GRCm39) T24A possibly damaging Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Muc4 C A 16: 32,580,479 (GRCm39) P360T Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or5w11 A G 2: 87,459,436 (GRCm39) I94V probably benign Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pmepa1 C T 2: 173,117,956 (GRCm39) A8T probably benign Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rpap1 G A 2: 119,594,891 (GRCm39) P1372L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sema3f A T 9: 107,560,774 (GRCm39) S644R probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tlcd4 A G 3: 121,028,690 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,070 (GRCm39) D747G probably damaging Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp423 T C 8: 88,507,905 (GRCm39) K813R probably damaging Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Lamc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Lamc2 APN 1 153,005,802 (GRCm39) missense probably benign 0.00
IGL00907:Lamc2 APN 1 153,020,397 (GRCm39) missense probably benign 0.32
IGL02026:Lamc2 APN 1 153,020,482 (GRCm39) splice site probably benign
IGL02335:Lamc2 APN 1 153,041,962 (GRCm39) missense probably benign 0.00
IGL02568:Lamc2 APN 1 153,042,008 (GRCm39) missense possibly damaging 0.91
IGL02640:Lamc2 APN 1 153,027,803 (GRCm39) missense probably damaging 0.99
IGL02801:Lamc2 APN 1 153,012,529 (GRCm39) missense probably benign 0.10
IGL02827:Lamc2 APN 1 153,015,527 (GRCm39) missense probably damaging 1.00
IGL03240:Lamc2 APN 1 152,999,871 (GRCm39) missense probably damaging 1.00
IGL03245:Lamc2 APN 1 153,009,503 (GRCm39) splice site probably null
abasement UTSW 1 153,002,771 (GRCm39) missense probably null 0.86
ANU74:Lamc2 UTSW 1 153,007,581 (GRCm39) missense probably benign 0.00
R0279:Lamc2 UTSW 1 153,006,442 (GRCm39) missense probably benign 0.01
R0528:Lamc2 UTSW 1 152,999,840 (GRCm39) missense probably damaging 1.00
R0597:Lamc2 UTSW 1 153,009,367 (GRCm39) missense probably benign 0.02
R0650:Lamc2 UTSW 1 153,019,622 (GRCm39) missense possibly damaging 0.88
R0826:Lamc2 UTSW 1 153,027,828 (GRCm39) missense probably damaging 1.00
R1015:Lamc2 UTSW 1 153,041,945 (GRCm39) missense possibly damaging 0.53
R1172:Lamc2 UTSW 1 153,042,033 (GRCm39) missense probably damaging 1.00
R1308:Lamc2 UTSW 1 153,026,564 (GRCm39) missense probably damaging 1.00
R1521:Lamc2 UTSW 1 153,042,009 (GRCm39) missense probably benign 0.11
R1525:Lamc2 UTSW 1 153,006,502 (GRCm39) missense probably benign 0.00
R1602:Lamc2 UTSW 1 153,002,774 (GRCm39) missense probably benign 0.00
R1631:Lamc2 UTSW 1 153,034,680 (GRCm39) missense possibly damaging 0.95
R1633:Lamc2 UTSW 1 153,017,444 (GRCm39) nonsense probably null
R1832:Lamc2 UTSW 1 153,041,933 (GRCm39) missense possibly damaging 0.72
R1978:Lamc2 UTSW 1 153,009,343 (GRCm39) critical splice donor site probably null
R1996:Lamc2 UTSW 1 153,030,216 (GRCm39) missense possibly damaging 0.84
R2046:Lamc2 UTSW 1 153,017,511 (GRCm39) missense probably benign 0.01
R2107:Lamc2 UTSW 1 153,030,132 (GRCm39) splice site probably benign
R2130:Lamc2 UTSW 1 153,002,870 (GRCm39) missense probably damaging 1.00
R2182:Lamc2 UTSW 1 153,002,612 (GRCm39) missense possibly damaging 0.46
R2207:Lamc2 UTSW 1 153,009,452 (GRCm39) missense possibly damaging 0.68
R2218:Lamc2 UTSW 1 153,006,525 (GRCm39) missense probably benign 0.21
R3772:Lamc2 UTSW 1 152,999,997 (GRCm39) missense probably benign
R4616:Lamc2 UTSW 1 153,041,915 (GRCm39) missense probably damaging 1.00
R4874:Lamc2 UTSW 1 153,030,141 (GRCm39) missense probably null 1.00
R4939:Lamc2 UTSW 1 153,002,582 (GRCm39) missense probably damaging 1.00
R4985:Lamc2 UTSW 1 153,012,551 (GRCm39) missense probably benign
R5544:Lamc2 UTSW 1 152,999,799 (GRCm39) missense possibly damaging 0.93
R5632:Lamc2 UTSW 1 153,007,636 (GRCm39) missense probably damaging 1.00
R5771:Lamc2 UTSW 1 153,017,340 (GRCm39) missense probably benign 0.04
R5811:Lamc2 UTSW 1 153,041,999 (GRCm39) missense possibly damaging 0.53
R6058:Lamc2 UTSW 1 153,012,575 (GRCm39) missense probably benign 0.01
R6130:Lamc2 UTSW 1 153,012,523 (GRCm39) missense probably benign 0.01
R6137:Lamc2 UTSW 1 153,041,899 (GRCm39) missense possibly damaging 0.90
R6994:Lamc2 UTSW 1 153,012,508 (GRCm39) missense probably benign 0.18
R6995:Lamc2 UTSW 1 153,012,508 (GRCm39) missense probably benign 0.18
R6997:Lamc2 UTSW 1 153,012,508 (GRCm39) missense probably benign 0.18
R7000:Lamc2 UTSW 1 153,041,873 (GRCm39) missense possibly damaging 0.72
R7018:Lamc2 UTSW 1 153,012,488 (GRCm39) missense probably benign 0.00
R7145:Lamc2 UTSW 1 153,006,518 (GRCm39) missense possibly damaging 0.95
R7148:Lamc2 UTSW 1 153,061,730 (GRCm39) missense probably benign 0.01
R7171:Lamc2 UTSW 1 153,015,495 (GRCm39) missense probably damaging 1.00
R7673:Lamc2 UTSW 1 152,999,782 (GRCm39) missense probably damaging 1.00
R7684:Lamc2 UTSW 1 153,002,771 (GRCm39) missense probably null 0.86
R7712:Lamc2 UTSW 1 153,009,357 (GRCm39) missense possibly damaging 0.81
R7940:Lamc2 UTSW 1 153,006,521 (GRCm39) nonsense probably null
R8153:Lamc2 UTSW 1 152,999,850 (GRCm39) frame shift probably null
R8211:Lamc2 UTSW 1 153,042,024 (GRCm39) missense probably damaging 1.00
R8486:Lamc2 UTSW 1 153,034,637 (GRCm39) missense probably benign
R8739:Lamc2 UTSW 1 153,020,399 (GRCm39) nonsense probably null
R8744:Lamc2 UTSW 1 153,019,484 (GRCm39) missense probably benign 0.19
R8911:Lamc2 UTSW 1 153,027,873 (GRCm39) missense probably damaging 1.00
R9435:Lamc2 UTSW 1 153,013,072 (GRCm39) missense probably benign 0.00
R9457:Lamc2 UTSW 1 153,015,600 (GRCm39) missense probably benign
RF024:Lamc2 UTSW 1 153,027,801 (GRCm39) missense possibly damaging 0.70
Z1176:Lamc2 UTSW 1 153,009,367 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TAGACAGGCCTGTGACAAAG -3'
(R):5'- TCAAGTCTTCAGCTTTGCGG -3'

Sequencing Primer
(F):5'- CACAGAGTCTGCCAGTGAGAC -3'
(R):5'- GGTTAACACGGTCATTCTGCATCAG -3'
Posted On 2019-10-24