Incidental Mutation 'R7640:Or5w11'
ID 590164
Institutional Source Beutler Lab
Gene Symbol Or5w11
Ensembl Gene ENSMUSG00000068819
Gene Name olfactory receptor family 5 subfamily W member 11
Synonyms GA_x6K02T2Q125-49133664-49134593, MOR177-4, Olfr1131
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 87458809-87459738 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87459436 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 94 (I94V)
Ref Sequence ENSEMBL: ENSMUSP00000148881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090712] [ENSMUST00000213302] [ENSMUST00000216082] [ENSMUST00000216756]
AlphaFold Q7TR45
Predicted Effect probably benign
Transcript: ENSMUST00000090712
AA Change: I210V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000088214
Gene: ENSMUSG00000068819
AA Change: I210V

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.2e-47 PFAM
Pfam:7tm_1 40 289 1.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213302
AA Change: I210V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216082
Predicted Effect probably benign
Transcript: ENSMUST00000216756
AA Change: I94V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Atr T G 9: 95,789,346 (GRCm39) probably null Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Clock G T 5: 76,396,225 (GRCm39) L175M possibly damaging Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Cuta C T 17: 27,157,396 (GRCm39) V135I probably benign Het
Ddx41 A T 13: 55,682,052 (GRCm39) M241K possibly damaging Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Fas A G 19: 34,284,564 (GRCm39) T24A possibly damaging Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Lamc2 A T 1: 153,012,550 (GRCm39) I708N possibly damaging Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Muc4 C A 16: 32,580,479 (GRCm39) P360T Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pmepa1 C T 2: 173,117,956 (GRCm39) A8T probably benign Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rpap1 G A 2: 119,594,891 (GRCm39) P1372L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sema3f A T 9: 107,560,774 (GRCm39) S644R probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tlcd4 A G 3: 121,028,690 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,070 (GRCm39) D747G probably damaging Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp423 T C 8: 88,507,905 (GRCm39) K813R probably damaging Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Or5w11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Or5w11 APN 2 87,458,973 (GRCm39) missense probably benign 0.03
IGL02186:Or5w11 APN 2 87,459,715 (GRCm39) missense probably benign 0.00
R0266:Or5w11 UTSW 2 87,459,626 (GRCm39) missense possibly damaging 0.79
R0849:Or5w11 UTSW 2 87,459,626 (GRCm39) missense possibly damaging 0.79
R1607:Or5w11 UTSW 2 87,459,321 (GRCm39) missense probably benign 0.14
R2077:Or5w11 UTSW 2 87,459,173 (GRCm39) missense probably damaging 1.00
R2105:Or5w11 UTSW 2 87,459,283 (GRCm39) missense probably benign 0.20
R2322:Or5w11 UTSW 2 87,459,118 (GRCm39) missense possibly damaging 0.86
R3434:Or5w11 UTSW 2 87,459,418 (GRCm39) missense probably benign 0.02
R4357:Or5w11 UTSW 2 87,458,810 (GRCm39) start codon destroyed probably null 1.00
R5139:Or5w11 UTSW 2 87,459,000 (GRCm39) missense probably benign 0.03
R5333:Or5w11 UTSW 2 87,459,458 (GRCm39) missense probably damaging 0.97
R5719:Or5w11 UTSW 2 87,459,475 (GRCm39) splice site probably null
R6449:Or5w11 UTSW 2 87,459,493 (GRCm39) missense possibly damaging 0.63
R7941:Or5w11 UTSW 2 87,459,248 (GRCm39) missense probably benign 0.06
R8110:Or5w11 UTSW 2 87,458,951 (GRCm39) missense possibly damaging 0.75
R8393:Or5w11 UTSW 2 87,459,197 (GRCm39) missense probably damaging 0.97
R8877:Or5w11 UTSW 2 87,459,212 (GRCm39) missense probably damaging 1.00
R9250:Or5w11 UTSW 2 87,459,278 (GRCm39) missense probably benign 0.02
R9290:Or5w11 UTSW 2 87,459,209 (GRCm39) missense probably benign 0.00
R9313:Or5w11 UTSW 2 87,459,076 (GRCm39) missense probably benign 0.03
R9666:Or5w11 UTSW 2 87,459,152 (GRCm39) missense possibly damaging 0.78
X0027:Or5w11 UTSW 2 87,459,647 (GRCm39) missense possibly damaging 0.96
Z1176:Or5w11 UTSW 2 87,459,659 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGGAACATCAGATGCTTTG -3'
(R):5'- GGTTCAGCATAGGAATCACAAG -3'

Sequencing Primer
(F):5'- GATACATACAACTTTGGCATTCCGC -3'
(R):5'- AGATGTCATTTTGTCTTGATCAAGG -3'
Posted On 2019-10-24