Incidental Mutation 'R7640:Olfr1131'
ID 590164
Institutional Source Beutler Lab
Gene Symbol Olfr1131
Ensembl Gene ENSMUSG00000068819
Gene Name olfactory receptor 1131
Synonyms GA_x6K02T2Q125-49133664-49134593, MOR177-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 87627104-87630203 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87629092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 94 (I94V)
Ref Sequence ENSEMBL: ENSMUSP00000148881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090712] [ENSMUST00000213302] [ENSMUST00000216082] [ENSMUST00000216756]
AlphaFold Q7TR45
Predicted Effect probably benign
Transcript: ENSMUST00000090712
AA Change: I210V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000088214
Gene: ENSMUSG00000068819
AA Change: I210V

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 5.2e-47 PFAM
Pfam:7tm_1 40 289 1.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213302
AA Change: I210V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216082
Predicted Effect probably benign
Transcript: ENSMUST00000216756
AA Change: I94V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Abcb6 A T 1: 75,174,845 probably null Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ankrd42 A G 7: 92,619,635 S167P probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Atr T G 9: 95,907,293 probably null Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Cnmd T A 14: 79,661,534 Y26F possibly damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
En2 A T 5: 28,170,166 K236* probably null Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
L2hgdh A T 12: 69,721,357 Y122* probably null Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mfap4 A G 11: 61,487,087 N118D probably damaging Het
Mknk2 T C 10: 80,668,566 S301G probably benign Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrc2 T A 11: 105,332,295 S455T possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Oas1b T C 5: 120,821,414 L288P probably damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Pmepa1 C T 2: 173,276,163 A8T probably benign Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rpap1 G A 2: 119,764,410 P1372L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sema3f A T 9: 107,683,575 S644R probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Specc1l T A 10: 75,257,869 N717K probably damaging Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zfp873 T C 10: 82,060,275 I280T possibly damaging Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in Olfr1131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Olfr1131 APN 2 87628629 missense probably benign 0.03
IGL02186:Olfr1131 APN 2 87629371 missense probably benign 0.00
R0266:Olfr1131 UTSW 2 87629282 missense possibly damaging 0.79
R0849:Olfr1131 UTSW 2 87629282 missense possibly damaging 0.79
R1607:Olfr1131 UTSW 2 87628977 missense probably benign 0.14
R2077:Olfr1131 UTSW 2 87628829 missense probably damaging 1.00
R2105:Olfr1131 UTSW 2 87628939 missense probably benign 0.20
R2322:Olfr1131 UTSW 2 87628774 missense possibly damaging 0.86
R3434:Olfr1131 UTSW 2 87629074 missense probably benign 0.02
R4357:Olfr1131 UTSW 2 87628466 start codon destroyed probably null 1.00
R5139:Olfr1131 UTSW 2 87628656 missense probably benign 0.03
R5333:Olfr1131 UTSW 2 87629114 missense probably damaging 0.97
R5719:Olfr1131 UTSW 2 87629131 splice site probably null
R6449:Olfr1131 UTSW 2 87629149 missense possibly damaging 0.63
R7941:Olfr1131 UTSW 2 87628904 missense probably benign 0.06
R8110:Olfr1131 UTSW 2 87628607 missense possibly damaging 0.75
R8393:Olfr1131 UTSW 2 87628853 missense probably damaging 0.97
R8877:Olfr1131 UTSW 2 87628868 missense probably damaging 1.00
R9250:Olfr1131 UTSW 2 87628934 missense probably benign 0.02
R9290:Olfr1131 UTSW 2 87628865 missense probably benign 0.00
R9313:Olfr1131 UTSW 2 87628732 missense probably benign 0.03
R9666:Olfr1131 UTSW 2 87628808 missense possibly damaging 0.78
X0027:Olfr1131 UTSW 2 87629303 missense possibly damaging 0.96
Z1176:Olfr1131 UTSW 2 87629315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGGGAACATCAGATGCTTTG -3'
(R):5'- GGTTCAGCATAGGAATCACAAG -3'

Sequencing Primer
(F):5'- GATACATACAACTTTGGCATTCCGC -3'
(R):5'- AGATGTCATTTTGTCTTGATCAAGG -3'
Posted On 2019-10-24