Incidental Mutation 'R7640:Rpap1'
ID590168
Institutional Source Beutler Lab
Gene Symbol Rpap1
Ensembl Gene ENSMUSG00000034032
Gene NameRNA polymerase II associated protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7640 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location119763304-119787537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119764410 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1372 (P1372L)
Ref Sequence ENSEMBL: ENSMUSP00000037275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028759] [ENSMUST00000048493] [ENSMUST00000082130] [ENSMUST00000099529] [ENSMUST00000110793] [ENSMUST00000136419] [ENSMUST00000184294]
Predicted Effect probably benign
Transcript: ENSMUST00000028759
SMART Domains Protein: ENSMUSP00000028759
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 111 381 2.4e-21 PFAM
transmembrane domain 423 445 N/A INTRINSIC
TyrKc 506 773 2.61e-127 SMART
low complexity region 824 841 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000048493
AA Change: P1372L

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037275
Gene: ENSMUSG00000034032
AA Change: P1372L

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 225 270 2.4e-21 PFAM
Pfam:RPAP1_C 372 438 1.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082130
SMART Domains Protein: ENSMUSP00000080774
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 109 294 6.1e-16 PFAM
transmembrane domain 362 384 N/A INTRINSIC
TyrKc 445 712 2.61e-127 SMART
low complexity region 763 780 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099529
AA Change: P1372L

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097127
Gene: ENSMUSG00000034032
AA Change: P1372L

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110793
AA Change: P1372L

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106420
Gene: ENSMUSG00000034032
AA Change: P1372L

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136419
SMART Domains Protein: ENSMUSP00000138619
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184294
SMART Domains Protein: ENSMUSP00000138873
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 4.8e-22 PFAM
Pfam:RPAP1_C 370 440 1.2e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein forms part of the RNA polymerase II (RNAPII) enzyme complex and may recruit RNAPII to chromatin through its interaction with acetylated histones. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Abcb6 A T 1: 75,174,845 probably null Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ankrd42 A G 7: 92,619,635 S167P probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Atr T G 9: 95,907,293 probably null Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Cnmd T A 14: 79,661,534 Y26F possibly damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
En2 A T 5: 28,170,166 K236* probably null Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
L2hgdh A T 12: 69,721,357 Y122* probably null Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mfap4 A G 11: 61,487,087 N118D probably damaging Het
Mknk2 T C 10: 80,668,566 S301G probably benign Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrc2 T A 11: 105,332,295 S455T possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Oas1b T C 5: 120,821,414 L288P probably damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1131 A G 2: 87,629,092 I94V probably benign Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Pmepa1 C T 2: 173,276,163 A8T probably benign Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sema3f A T 9: 107,683,575 S644R probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Specc1l T A 10: 75,257,869 N717K probably damaging Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zfp873 T C 10: 82,060,275 I280T possibly damaging Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in Rpap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Rpap1 APN 2 119782708 missense possibly damaging 0.50
IGL02009:Rpap1 APN 2 119780113 missense possibly damaging 0.51
IGL02068:Rpap1 APN 2 119782654 missense probably benign 0.02
IGL02100:Rpap1 APN 2 119769326 missense probably benign 0.06
IGL02528:Rpap1 APN 2 119774950 splice site probably null
IGL02530:Rpap1 APN 2 119783239 splice site probably benign
IGL02747:Rpap1 APN 2 119774128 missense probably damaging 0.98
IGL03371:Rpap1 APN 2 119775057 splice site probably benign
R0138:Rpap1 UTSW 2 119764899 unclassified probably null
R0325:Rpap1 UTSW 2 119771840 missense probably benign
R0616:Rpap1 UTSW 2 119778120 missense probably damaging 1.00
R1081:Rpap1 UTSW 2 119771269 missense probably damaging 1.00
R1657:Rpap1 UTSW 2 119783778 missense possibly damaging 0.53
R1837:Rpap1 UTSW 2 119769885 critical splice donor site probably null
R2307:Rpap1 UTSW 2 119783766 missense probably benign 0.00
R2308:Rpap1 UTSW 2 119783766 missense probably benign 0.00
R2375:Rpap1 UTSW 2 119770407 missense possibly damaging 0.50
R2507:Rpap1 UTSW 2 119780054 critical splice donor site probably null
R2508:Rpap1 UTSW 2 119780054 critical splice donor site probably null
R4155:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4156:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4157:Rpap1 UTSW 2 119774179 missense probably damaging 1.00
R4657:Rpap1 UTSW 2 119775006 missense probably benign 0.03
R4837:Rpap1 UTSW 2 119778251 missense probably benign 0.32
R4880:Rpap1 UTSW 2 119783865 missense probably damaging 0.97
R5010:Rpap1 UTSW 2 119770041 missense probably benign
R5111:Rpap1 UTSW 2 119771247 missense probably damaging 1.00
R5650:Rpap1 UTSW 2 119773850 missense probably benign
R6144:Rpap1 UTSW 2 119772647 nonsense probably null
R6353:Rpap1 UTSW 2 119776896 splice site probably null
R6646:Rpap1 UTSW 2 119780131 missense probably benign 0.03
R6731:Rpap1 UTSW 2 119778296 missense probably benign
R6872:Rpap1 UTSW 2 119775369 missense probably damaging 1.00
R6878:Rpap1 UTSW 2 119778176 missense probably damaging 1.00
R7060:Rpap1 UTSW 2 119773562 missense probably damaging 1.00
R7558:Rpap1 UTSW 2 119771254 missense probably benign
R7862:Rpap1 UTSW 2 119775412 critical splice acceptor site probably null
R8055:Rpap1 UTSW 2 119764803 missense probably benign 0.13
X0028:Rpap1 UTSW 2 119771062 missense probably benign
Z1177:Rpap1 UTSW 2 119783752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAAGTCTTGTGTTGCC -3'
(R):5'- CAGGATGAGGTAAAGACTGCCC -3'

Sequencing Primer
(F):5'- TTCTCTCGGGAGGCTCACTG -3'
(R):5'- CGAAGGAGTATGCTGCAGAGAAC -3'
Posted On2019-10-24