Incidental Mutation 'R7640:Rpap1'
ID 590168
Institutional Source Beutler Lab
Gene Symbol Rpap1
Ensembl Gene ENSMUSG00000034032
Gene Name RNA polymerase II associated protein 1
Synonyms A730023M06Rik, 1190005L06Rik
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 119594440-119618018 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119594891 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 1372 (P1372L)
Ref Sequence ENSEMBL: ENSMUSP00000037275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028759] [ENSMUST00000048493] [ENSMUST00000082130] [ENSMUST00000099529] [ENSMUST00000110793] [ENSMUST00000136419] [ENSMUST00000184294]
AlphaFold Q80TE0
Predicted Effect probably benign
Transcript: ENSMUST00000028759
SMART Domains Protein: ENSMUSP00000028759
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 111 381 2.4e-21 PFAM
transmembrane domain 423 445 N/A INTRINSIC
TyrKc 506 773 2.61e-127 SMART
low complexity region 824 841 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000048493
AA Change: P1372L

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000037275
Gene: ENSMUSG00000034032
AA Change: P1372L

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 225 270 2.4e-21 PFAM
Pfam:RPAP1_C 372 438 1.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082130
SMART Domains Protein: ENSMUSP00000080774
Gene: ENSMUSG00000027297

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Gly_rich 109 294 6.1e-16 PFAM
transmembrane domain 362 384 N/A INTRINSIC
TyrKc 445 712 2.61e-127 SMART
low complexity region 763 780 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099529
AA Change: P1372L

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097127
Gene: ENSMUSG00000034032
AA Change: P1372L

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110793
AA Change: P1372L

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106420
Gene: ENSMUSG00000034032
AA Change: P1372L

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 1.7e-21 PFAM
Pfam:RPAP1_C 370 440 2.9e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
low complexity region 989 1007 N/A INTRINSIC
low complexity region 1042 1052 N/A INTRINSIC
low complexity region 1097 1108 N/A INTRINSIC
low complexity region 1193 1204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136419
SMART Domains Protein: ENSMUSP00000138619
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184294
SMART Domains Protein: ENSMUSP00000138873
Gene: ENSMUSG00000034032

DomainStartEndE-ValueType
low complexity region 62 81 N/A INTRINSIC
Pfam:RPAP1_N 224 272 4.8e-22 PFAM
Pfam:RPAP1_C 370 440 1.2e-27 PFAM
low complexity region 451 473 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 739 752 N/A INTRINSIC
low complexity region 843 860 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein forms part of the RNA polymerase II (RNAPII) enzyme complex and may recruit RNAPII to chromatin through its interaction with acetylated histones. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Atr T G 9: 95,789,346 (GRCm39) probably null Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Clock G T 5: 76,396,225 (GRCm39) L175M possibly damaging Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Cuta C T 17: 27,157,396 (GRCm39) V135I probably benign Het
Ddx41 A T 13: 55,682,052 (GRCm39) M241K possibly damaging Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Fas A G 19: 34,284,564 (GRCm39) T24A possibly damaging Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Lamc2 A T 1: 153,012,550 (GRCm39) I708N possibly damaging Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Muc4 C A 16: 32,580,479 (GRCm39) P360T Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or5w11 A G 2: 87,459,436 (GRCm39) I94V probably benign Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pmepa1 C T 2: 173,117,956 (GRCm39) A8T probably benign Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sema3f A T 9: 107,560,774 (GRCm39) S644R probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tlcd4 A G 3: 121,028,690 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,070 (GRCm39) D747G probably damaging Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp423 T C 8: 88,507,905 (GRCm39) K813R probably damaging Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Rpap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01807:Rpap1 APN 2 119,613,189 (GRCm39) missense possibly damaging 0.50
IGL02009:Rpap1 APN 2 119,610,594 (GRCm39) missense possibly damaging 0.51
IGL02068:Rpap1 APN 2 119,613,135 (GRCm39) missense probably benign 0.02
IGL02100:Rpap1 APN 2 119,599,807 (GRCm39) missense probably benign 0.06
IGL02528:Rpap1 APN 2 119,605,431 (GRCm39) splice site probably null
IGL02530:Rpap1 APN 2 119,613,720 (GRCm39) splice site probably benign
IGL02747:Rpap1 APN 2 119,604,609 (GRCm39) missense probably damaging 0.98
IGL03371:Rpap1 APN 2 119,605,538 (GRCm39) splice site probably benign
R0138:Rpap1 UTSW 2 119,595,380 (GRCm39) splice site probably null
R0325:Rpap1 UTSW 2 119,602,321 (GRCm39) missense probably benign
R0616:Rpap1 UTSW 2 119,608,601 (GRCm39) missense probably damaging 1.00
R1081:Rpap1 UTSW 2 119,601,750 (GRCm39) missense probably damaging 1.00
R1657:Rpap1 UTSW 2 119,614,259 (GRCm39) missense possibly damaging 0.53
R1837:Rpap1 UTSW 2 119,600,366 (GRCm39) critical splice donor site probably null
R2307:Rpap1 UTSW 2 119,614,247 (GRCm39) missense probably benign 0.00
R2308:Rpap1 UTSW 2 119,614,247 (GRCm39) missense probably benign 0.00
R2375:Rpap1 UTSW 2 119,600,888 (GRCm39) missense possibly damaging 0.50
R2507:Rpap1 UTSW 2 119,610,535 (GRCm39) critical splice donor site probably null
R2508:Rpap1 UTSW 2 119,610,535 (GRCm39) critical splice donor site probably null
R4155:Rpap1 UTSW 2 119,604,660 (GRCm39) missense probably damaging 1.00
R4156:Rpap1 UTSW 2 119,604,660 (GRCm39) missense probably damaging 1.00
R4157:Rpap1 UTSW 2 119,604,660 (GRCm39) missense probably damaging 1.00
R4657:Rpap1 UTSW 2 119,605,487 (GRCm39) missense probably benign 0.03
R4837:Rpap1 UTSW 2 119,608,732 (GRCm39) missense probably benign 0.32
R4880:Rpap1 UTSW 2 119,614,346 (GRCm39) missense probably damaging 0.97
R5010:Rpap1 UTSW 2 119,600,522 (GRCm39) missense probably benign
R5111:Rpap1 UTSW 2 119,601,728 (GRCm39) missense probably damaging 1.00
R5650:Rpap1 UTSW 2 119,604,331 (GRCm39) missense probably benign
R6144:Rpap1 UTSW 2 119,603,128 (GRCm39) nonsense probably null
R6353:Rpap1 UTSW 2 119,607,377 (GRCm39) splice site probably null
R6646:Rpap1 UTSW 2 119,610,612 (GRCm39) missense probably benign 0.03
R6731:Rpap1 UTSW 2 119,608,777 (GRCm39) missense probably benign
R6872:Rpap1 UTSW 2 119,605,850 (GRCm39) missense probably damaging 1.00
R6878:Rpap1 UTSW 2 119,608,657 (GRCm39) missense probably damaging 1.00
R7060:Rpap1 UTSW 2 119,604,043 (GRCm39) missense probably damaging 1.00
R7558:Rpap1 UTSW 2 119,601,735 (GRCm39) missense probably benign
R7862:Rpap1 UTSW 2 119,605,893 (GRCm39) critical splice acceptor site probably null
R8055:Rpap1 UTSW 2 119,595,284 (GRCm39) missense probably benign 0.13
R8934:Rpap1 UTSW 2 119,599,730 (GRCm39) critical splice donor site probably null
R9032:Rpap1 UTSW 2 119,608,776 (GRCm39) missense probably benign 0.00
R9220:Rpap1 UTSW 2 119,604,669 (GRCm39) missense probably damaging 0.99
R9422:Rpap1 UTSW 2 119,613,519 (GRCm39) intron probably benign
R9651:Rpap1 UTSW 2 119,598,484 (GRCm39) missense probably damaging 1.00
R9776:Rpap1 UTSW 2 119,607,278 (GRCm39) missense probably benign 0.00
X0028:Rpap1 UTSW 2 119,601,543 (GRCm39) missense probably benign
Z1177:Rpap1 UTSW 2 119,614,233 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAAGTCTTGTGTTGCC -3'
(R):5'- CAGGATGAGGTAAAGACTGCCC -3'

Sequencing Primer
(F):5'- TTCTCTCGGGAGGCTCACTG -3'
(R):5'- CGAAGGAGTATGCTGCAGAGAAC -3'
Posted On 2019-10-24