Incidental Mutation 'R7640:Pmepa1'
ID 590169
Institutional Source Beutler Lab
Gene Symbol Pmepa1
Ensembl Gene ENSMUSG00000038400
Gene Name prostate transmembrane protein, androgen induced 1
Synonyms N4wbp4, Tmepai, 2210418I02Rik, PMEPA1, STAG1
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7640 (G1)
Quality Score 82.0076
Status Not validated
Chromosome 2
Chromosomal Location 173066251-173118326 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 173117956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 8 (A8T)
Ref Sequence ENSEMBL: ENSMUSP00000115534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036248] [ENSMUST00000139306]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000036248
AA Change: A8T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039950
Gene: ENSMUSG00000038400
AA Change: A8T

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139306
AA Change: A8T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000115534
Gene: ENSMUSG00000038400
AA Change: A8T

DomainStartEndE-ValueType
transmembrane domain 75 97 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains a Smad interacting motif (SIM). Expression of this gene is induced by androgens and transforming growth factor beta, and the encoded protein suppresses the androgen receptor and transforming growth factor beta signaling pathways though interactions with Smad proteins. Overexpression of this gene may play a role in multiple types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Atr T G 9: 95,789,346 (GRCm39) probably null Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Clock G T 5: 76,396,225 (GRCm39) L175M possibly damaging Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Cuta C T 17: 27,157,396 (GRCm39) V135I probably benign Het
Ddx41 A T 13: 55,682,052 (GRCm39) M241K possibly damaging Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Fas A G 19: 34,284,564 (GRCm39) T24A possibly damaging Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Lamc2 A T 1: 153,012,550 (GRCm39) I708N possibly damaging Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Muc4 C A 16: 32,580,479 (GRCm39) P360T Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or5w11 A G 2: 87,459,436 (GRCm39) I94V probably benign Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rpap1 G A 2: 119,594,891 (GRCm39) P1372L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sema3f A T 9: 107,560,774 (GRCm39) S644R probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tlcd4 A G 3: 121,028,690 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,070 (GRCm39) D747G probably damaging Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp423 T C 8: 88,507,905 (GRCm39) K813R probably damaging Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Pmepa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1401:Pmepa1 UTSW 2 173,070,368 (GRCm39) critical splice donor site probably null
R1439:Pmepa1 UTSW 2 173,069,874 (GRCm39) missense probably benign 0.13
R1772:Pmepa1 UTSW 2 173,076,153 (GRCm39) missense probably damaging 1.00
R2228:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R2229:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R2380:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R2381:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R2382:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R2385:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R2386:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R3783:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R3784:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R3785:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R3787:Pmepa1 UTSW 2 173,069,926 (GRCm39) missense probably damaging 1.00
R4600:Pmepa1 UTSW 2 173,070,120 (GRCm39) missense possibly damaging 0.81
R5368:Pmepa1 UTSW 2 173,070,115 (GRCm39) missense probably damaging 1.00
R5982:Pmepa1 UTSW 2 173,076,105 (GRCm39) missense possibly damaging 0.82
R7371:Pmepa1 UTSW 2 173,076,212 (GRCm39) missense possibly damaging 0.73
R8221:Pmepa1 UTSW 2 173,069,700 (GRCm39) missense probably damaging 1.00
R8810:Pmepa1 UTSW 2 173,069,628 (GRCm39) missense probably damaging 0.99
R9227:Pmepa1 UTSW 2 173,117,962 (GRCm39) missense probably benign 0.06
R9228:Pmepa1 UTSW 2 173,117,962 (GRCm39) missense probably benign 0.06
R9229:Pmepa1 UTSW 2 173,117,962 (GRCm39) missense probably benign 0.06
R9260:Pmepa1 UTSW 2 173,117,943 (GRCm39) small deletion probably benign
R9568:Pmepa1 UTSW 2 173,069,794 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTAATTGCTCCATCGCC -3'
(R):5'- CTTGGACTTGAATGAGGAGCG -3'

Sequencing Primer
(F):5'- CGGAATGGAAACTTCCCCGAC -3'
(R):5'- GCTCAGCTGCGGATCGG -3'
Posted On 2019-10-24