Incidental Mutation 'R7640:Pmepa1'
ID590169
Institutional Source Beutler Lab
Gene Symbol Pmepa1
Ensembl Gene ENSMUSG00000038400
Gene Nameprostate transmembrane protein, androgen induced 1
SynonymsN4wbp4, Tmepai, 2210418I02Rik, PMEPA1, STAG1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7640 (G1)
Quality Score82.0076
Status Not validated
Chromosome2
Chromosomal Location173224458-173276533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 173276163 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 8 (A8T)
Ref Sequence ENSEMBL: ENSMUSP00000115534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036248] [ENSMUST00000139306]
Predicted Effect probably benign
Transcript: ENSMUST00000036248
AA Change: A8T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039950
Gene: ENSMUSG00000038400
AA Change: A8T

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139306
AA Change: A8T

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000115534
Gene: ENSMUSG00000038400
AA Change: A8T

DomainStartEndE-ValueType
transmembrane domain 75 97 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that contains a Smad interacting motif (SIM). Expression of this gene is induced by androgens and transforming growth factor beta, and the encoded protein suppresses the androgen receptor and transforming growth factor beta signaling pathways though interactions with Smad proteins. Overexpression of this gene may play a role in multiple types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ankrd42 A G 7: 92,619,635 S167P probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Cnmd T A 14: 79,661,534 Y26F possibly damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
En2 A T 5: 28,170,166 K236* probably null Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
L2hgdh A T 12: 69,721,357 Y122* probably null Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mfap4 A G 11: 61,487,087 N118D probably damaging Het
Mknk2 T C 10: 80,668,566 S301G probably benign Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrc2 T A 11: 105,332,295 S455T possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1131 A G 2: 87,629,092 I94V probably benign Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rpap1 G A 2: 119,764,410 P1372L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Specc1l T A 10: 75,257,869 N717K probably damaging Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zfp873 T C 10: 82,060,275 I280T possibly damaging Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in Pmepa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1401:Pmepa1 UTSW 2 173228575 critical splice donor site probably null
R1439:Pmepa1 UTSW 2 173228081 missense probably benign 0.13
R1772:Pmepa1 UTSW 2 173234360 missense probably damaging 1.00
R2228:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2229:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2380:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2381:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2382:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2385:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R2386:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3783:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3784:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3785:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R3787:Pmepa1 UTSW 2 173228133 missense probably damaging 1.00
R4600:Pmepa1 UTSW 2 173228327 missense possibly damaging 0.81
R5368:Pmepa1 UTSW 2 173228322 missense probably damaging 1.00
R5982:Pmepa1 UTSW 2 173234312 missense possibly damaging 0.82
R7371:Pmepa1 UTSW 2 173234419 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGCCTAATTGCTCCATCGCC -3'
(R):5'- CTTGGACTTGAATGAGGAGCG -3'

Sequencing Primer
(F):5'- CGGAATGGAAACTTCCCCGAC -3'
(R):5'- GCTCAGCTGCGGATCGG -3'
Posted On2019-10-24