Incidental Mutation 'R7640:Tlcd4'
ID 590173
Institutional Source Beutler Lab
Gene Symbol Tlcd4
Ensembl Gene ENSMUSG00000028132
Gene Name TLC domain containing 4
Synonyms C730036B01Rik, 4930577M16Rik, Tmem56
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 120995657-121076756 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 121028690 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029777] [ENSMUST00000128909] [ENSMUST00000135818] [ENSMUST00000137234] [ENSMUST00000155309]
AlphaFold Q8CGF5
Predicted Effect probably null
Transcript: ENSMUST00000029777
SMART Domains Protein: ENSMUSP00000029777
Gene: ENSMUSG00000028132

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
TLC 57 259 1.5e-47 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128909
SMART Domains Protein: ENSMUSP00000119468
Gene: ENSMUSG00000028132

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
TLC 57 259 1.5e-47 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135818
SMART Domains Protein: ENSMUSP00000114755
Gene: ENSMUSG00000028132

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
TLC 57 231 4.68e-26 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137234
SMART Domains Protein: ENSMUSP00000122001
Gene: ENSMUSG00000028132

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:TRAM_LAG1_CLN8 61 138 7.8e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000155309
SMART Domains Protein: ENSMUSP00000120821
Gene: ENSMUSG00000028132

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
TLC 57 259 1.5e-47 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Atr T G 9: 95,789,346 (GRCm39) probably null Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Clock G T 5: 76,396,225 (GRCm39) L175M possibly damaging Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Cuta C T 17: 27,157,396 (GRCm39) V135I probably benign Het
Ddx41 A T 13: 55,682,052 (GRCm39) M241K possibly damaging Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Fas A G 19: 34,284,564 (GRCm39) T24A possibly damaging Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Lamc2 A T 1: 153,012,550 (GRCm39) I708N possibly damaging Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Muc4 C A 16: 32,580,479 (GRCm39) P360T Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or5w11 A G 2: 87,459,436 (GRCm39) I94V probably benign Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pmepa1 C T 2: 173,117,956 (GRCm39) A8T probably benign Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rpap1 G A 2: 119,594,891 (GRCm39) P1372L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sema3f A T 9: 107,560,774 (GRCm39) S644R probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tmem132c A G 5: 127,640,070 (GRCm39) D747G probably damaging Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp423 T C 8: 88,507,905 (GRCm39) K813R probably damaging Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Tlcd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02606:Tlcd4 APN 3 121,022,013 (GRCm39) missense possibly damaging 0.94
IGL03339:Tlcd4 APN 3 121,022,489 (GRCm39) splice site probably benign
R1295:Tlcd4 UTSW 3 121,000,940 (GRCm39) missense probably benign
R1296:Tlcd4 UTSW 3 121,000,940 (GRCm39) missense probably benign
R2040:Tlcd4 UTSW 3 121,024,975 (GRCm39) splice site probably benign
R2056:Tlcd4 UTSW 3 121,001,070 (GRCm39) missense probably benign 0.00
R4541:Tlcd4 UTSW 3 121,028,884 (GRCm39) start codon destroyed probably null 0.00
R6044:Tlcd4 UTSW 3 121,001,018 (GRCm39) missense probably damaging 0.97
R6261:Tlcd4 UTSW 3 121,028,708 (GRCm39) missense possibly damaging 0.86
R6916:Tlcd4 UTSW 3 121,000,805 (GRCm39) missense possibly damaging 0.94
R7911:Tlcd4 UTSW 3 121,022,041 (GRCm39) missense probably damaging 0.96
R9404:Tlcd4 UTSW 3 121,028,731 (GRCm39) missense probably benign 0.00
RF010:Tlcd4 UTSW 3 121,022,533 (GRCm39) missense probably benign 0.00
Z1177:Tlcd4 UTSW 3 121,004,957 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACAGTCAGCTAGCATCTACTCC -3'
(R):5'- TCCCAGGCTGAAGGACTATG -3'

Sequencing Primer
(F):5'- CTCAGATCTTGTGAAAGAGCAGCC -3'
(R):5'- CTATGGAGGCGAGTACCAAGGC -3'
Posted On 2019-10-24