Incidental Mutation 'R7640:En2'
ID 590179
Institutional Source Beutler Lab
Gene Symbol En2
Ensembl Gene ENSMUSG00000039095
Gene Name engrailed 2
Synonyms En-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 28165694-28172166 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 28170166 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 236 (K236*)
Ref Sequence ENSEMBL: ENSMUSP00000036761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036177]
AlphaFold P09066
Predicted Effect probably null
Transcript: ENSMUST00000036177
AA Change: K236*
SMART Domains Protein: ENSMUSP00000036761
Gene: ENSMUSG00000039095
AA Change: K236*

DomainStartEndE-ValueType
low complexity region 21 39 N/A INTRINSIC
low complexity region 81 112 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
HOX 235 297 1.72e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeobox-containing genes are thought to have a role in controlling development. In Drosophila, the 'engrailed' (en) gene plays an important role during development in segmentation, where it is required for the formation of posterior compartments. Different mutations in the mouse homologs, En1 and En2, produced different developmental defects that frequently are lethal. The human engrailed homologs 1 and 2 encode homeodomain-containing proteins and have been implicated in the control of pattern formation during development of the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: This locus affects anterior-posterior cerebellar patterning. Homozygous null mutants show altered foliation pattern and perform poorly in motor learning (rotarod) tests. Heterozygotes test intermediate on rotarod. Hypomorphs show no phenotypic effects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Abcb6 A T 1: 75,174,845 probably null Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ankrd42 A G 7: 92,619,635 S167P probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Atr T G 9: 95,907,293 probably null Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Cnmd T A 14: 79,661,534 Y26F possibly damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
L2hgdh A T 12: 69,721,357 Y122* probably null Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mfap4 A G 11: 61,487,087 N118D probably damaging Het
Mknk2 T C 10: 80,668,566 S301G probably benign Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrc2 T A 11: 105,332,295 S455T possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Oas1b T C 5: 120,821,414 L288P probably damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1131 A G 2: 87,629,092 I94V probably benign Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Pmepa1 C T 2: 173,276,163 A8T probably benign Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rpap1 G A 2: 119,764,410 P1372L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sema3f A T 9: 107,683,575 S644R probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Specc1l T A 10: 75,257,869 N717K probably damaging Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zfp873 T C 10: 82,060,275 I280T possibly damaging Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in En2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02943:En2 APN 5 28166526 utr 5 prime probably benign
R0928:En2 UTSW 5 28170331 nonsense probably null
R2083:En2 UTSW 5 28167073 missense probably damaging 0.98
R2356:En2 UTSW 5 28166332 start gained probably benign
R2762:En2 UTSW 5 28170421 missense probably damaging 0.99
R5470:En2 UTSW 5 28166924 missense probably benign 0.03
R5760:En2 UTSW 5 28166999 missense probably benign 0.41
R6762:En2 UTSW 5 28170353 missense possibly damaging 0.65
R7687:En2 UTSW 5 28170289 missense probably damaging 1.00
R7827:En2 UTSW 5 28166596 missense probably benign
R8409:En2 UTSW 5 28166884 missense probably benign
R8861:En2 UTSW 5 28166735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATGCCCAACACTTGTATGG -3'
(R):5'- GCACCGCCAAAGTGTTCTTG -3'

Sequencing Primer
(F):5'- CCAACACTTGTATGGCCTTGGG -3'
(R):5'- GCCAAAGTGTTCTTGTTGCC -3'
Posted On 2019-10-24