Incidental Mutation 'R7640:Clock'
ID 590180
Institutional Source Beutler Lab
Gene Symbol Clock
Ensembl Gene ENSMUSG00000029238
Gene Name clock circadian regulator
Synonyms bHLHe8, KAT13D, 5330400M04Rik
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.794) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 76357715-76452639 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 76396225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 175 (L175M)
Ref Sequence ENSEMBL: ENSMUSP00000074656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075159] [ENSMUST00000202122] [ENSMUST00000202651]
AlphaFold O08785
PDB Structure Crystal Structure of the Heterodimeric CLOCK:BMAL1 Transcriptional Activator Complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075159
AA Change: L175M

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074656
Gene: ENSMUSG00000029238
AA Change: L175M

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202122
AA Change: L175M

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144022
Gene: ENSMUSG00000029238
AA Change: L175M

DomainStartEndE-ValueType
TFS2N 34 106 4.1e-3 SMART
HLH 40 90 3.4e-14 SMART
PAS 109 175 9.6e-9 SMART
PAS 264 330 1.8e-6 SMART
PAC 336 379 3.9e-9 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 633 N/A INTRINSIC
low complexity region 639 656 N/A INTRINSIC
low complexity region 737 795 N/A INTRINSIC
low complexity region 817 836 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202651
AA Change: L175M

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143939
Gene: ENSMUSG00000029238
AA Change: L175M

DomainStartEndE-ValueType
HLH 40 90 7.77e-12 SMART
PAS 109 175 1.88e-6 SMART
PAS 264 330 3.65e-4 SMART
PAC 336 379 7.63e-7 SMART
low complexity region 426 446 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
coiled coil region 523 559 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 640 657 N/A INTRINSIC
low complexity region 738 796 N/A INTRINSIC
low complexity region 818 837 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: The protein encoded by this gene plays a central role in the regulation of circadian rhythms. The protein encodes a transcription factor of the basic helix-loop-helix (bHLH) family and contains DNA binding histone acetyltransferase activity. The encoded protein forms a heterodimer with Arntl (Bmal1) that binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Polymorphisms in this gene may be associated with behavioral changes, obesity, and metabolic syndrome. Two transcripts encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal circadian phase. Mice homozygous for a spontaneous mutation exhibit abnormal circadian rhythm, reproduction, behavior, hair cycle, macronutrient absorption, and metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Atr T G 9: 95,789,346 (GRCm39) probably null Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Cuta C T 17: 27,157,396 (GRCm39) V135I probably benign Het
Ddx41 A T 13: 55,682,052 (GRCm39) M241K possibly damaging Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Fas A G 19: 34,284,564 (GRCm39) T24A possibly damaging Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Lamc2 A T 1: 153,012,550 (GRCm39) I708N possibly damaging Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Muc4 C A 16: 32,580,479 (GRCm39) P360T Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or5w11 A G 2: 87,459,436 (GRCm39) I94V probably benign Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pmepa1 C T 2: 173,117,956 (GRCm39) A8T probably benign Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rpap1 G A 2: 119,594,891 (GRCm39) P1372L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sema3f A T 9: 107,560,774 (GRCm39) S644R probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tlcd4 A G 3: 121,028,690 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,070 (GRCm39) D747G probably damaging Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp423 T C 8: 88,507,905 (GRCm39) K813R probably damaging Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Clock
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Clock APN 5 76,377,311 (GRCm39) missense probably benign 0.17
IGL00725:Clock APN 5 76,402,260 (GRCm39) nonsense probably null
IGL01304:Clock APN 5 76,414,202 (GRCm39) critical splice donor site probably null
IGL01369:Clock APN 5 76,384,933 (GRCm39) missense probably benign 0.30
IGL01542:Clock APN 5 76,379,322 (GRCm39) missense possibly damaging 0.82
IGL02541:Clock APN 5 76,410,519 (GRCm39) splice site probably null
IGL02602:Clock APN 5 76,402,274 (GRCm39) missense probably damaging 1.00
IGL02602:Clock APN 5 76,402,273 (GRCm39) missense probably null 1.00
IGL03186:Clock APN 5 76,390,929 (GRCm39) missense probably damaging 0.98
IGL03309:Clock APN 5 76,379,241 (GRCm39) critical splice donor site probably null
R6760_Clock_188 UTSW 5 76,374,823 (GRCm39) missense unknown
uhr UTSW 5 76,377,401 (GRCm39) nonsense probably null
R0304:Clock UTSW 5 76,374,832 (GRCm39) missense unknown
R0593:Clock UTSW 5 76,413,683 (GRCm39) missense probably benign 0.25
R0654:Clock UTSW 5 76,374,976 (GRCm39) missense possibly damaging 0.95
R0684:Clock UTSW 5 76,393,365 (GRCm39) missense probably damaging 0.96
R0707:Clock UTSW 5 76,374,976 (GRCm39) missense possibly damaging 0.95
R0751:Clock UTSW 5 76,377,208 (GRCm39) missense possibly damaging 0.75
R0865:Clock UTSW 5 76,414,271 (GRCm39) splice site probably benign
R0920:Clock UTSW 5 76,378,167 (GRCm39) missense possibly damaging 0.80
R1396:Clock UTSW 5 76,414,649 (GRCm39) missense probably benign 0.00
R1450:Clock UTSW 5 76,410,578 (GRCm39) nonsense probably null
R1487:Clock UTSW 5 76,414,201 (GRCm39) splice site probably null
R1574:Clock UTSW 5 76,390,679 (GRCm39) missense probably damaging 1.00
R1574:Clock UTSW 5 76,390,679 (GRCm39) missense probably damaging 1.00
R1858:Clock UTSW 5 76,388,756 (GRCm39) missense possibly damaging 0.92
R1872:Clock UTSW 5 76,396,309 (GRCm39) missense possibly damaging 0.67
R1905:Clock UTSW 5 76,414,735 (GRCm39) splice site probably benign
R1937:Clock UTSW 5 76,377,340 (GRCm39) missense probably damaging 0.99
R2411:Clock UTSW 5 76,379,360 (GRCm39) missense probably benign 0.08
R2887:Clock UTSW 5 76,393,120 (GRCm39) missense probably damaging 0.99
R3410:Clock UTSW 5 76,377,401 (GRCm39) nonsense probably null
R4514:Clock UTSW 5 76,378,046 (GRCm39) missense probably benign 0.00
R4598:Clock UTSW 5 76,383,657 (GRCm39) missense probably benign 0.00
R4599:Clock UTSW 5 76,383,657 (GRCm39) missense probably benign 0.00
R4795:Clock UTSW 5 76,413,763 (GRCm39) missense probably damaging 1.00
R4796:Clock UTSW 5 76,413,763 (GRCm39) missense probably damaging 1.00
R4973:Clock UTSW 5 76,402,258 (GRCm39) missense possibly damaging 0.62
R5204:Clock UTSW 5 76,391,017 (GRCm39) splice site probably null
R5271:Clock UTSW 5 76,389,801 (GRCm39) missense probably damaging 1.00
R5547:Clock UTSW 5 76,378,185 (GRCm39) missense probably benign 0.02
R5630:Clock UTSW 5 76,378,185 (GRCm39) missense probably benign 0.02
R5631:Clock UTSW 5 76,378,185 (GRCm39) missense probably benign 0.02
R5632:Clock UTSW 5 76,378,185 (GRCm39) missense probably benign 0.02
R5787:Clock UTSW 5 76,384,898 (GRCm39) missense probably damaging 1.00
R6274:Clock UTSW 5 76,385,000 (GRCm39) missense probably benign 0.45
R6578:Clock UTSW 5 76,364,556 (GRCm39) missense unknown
R6622:Clock UTSW 5 76,389,801 (GRCm39) missense probably damaging 1.00
R6760:Clock UTSW 5 76,374,823 (GRCm39) missense unknown
R6793:Clock UTSW 5 76,384,967 (GRCm39) frame shift probably null
R7406:Clock UTSW 5 76,414,692 (GRCm39) start codon destroyed probably null 0.26
R7414:Clock UTSW 5 76,410,611 (GRCm39) missense probably benign 0.00
R7560:Clock UTSW 5 76,390,738 (GRCm39) splice site probably null
R7593:Clock UTSW 5 76,384,145 (GRCm39) missense possibly damaging 0.80
R7708:Clock UTSW 5 76,414,256 (GRCm39) missense probably benign 0.00
R7713:Clock UTSW 5 76,393,267 (GRCm39) critical splice donor site probably null
R7807:Clock UTSW 5 76,390,982 (GRCm39) missense probably benign 0.01
R8171:Clock UTSW 5 76,414,261 (GRCm39) missense possibly damaging 0.94
R8190:Clock UTSW 5 76,375,051 (GRCm39) missense probably damaging 0.98
R8225:Clock UTSW 5 76,389,759 (GRCm39) missense probably damaging 0.99
R8309:Clock UTSW 5 76,402,269 (GRCm39) missense probably benign 0.07
R8557:Clock UTSW 5 76,377,217 (GRCm39) missense probably damaging 1.00
R8792:Clock UTSW 5 76,410,574 (GRCm39) missense probably damaging 1.00
R8869:Clock UTSW 5 76,374,889 (GRCm39) small deletion probably benign
R8870:Clock UTSW 5 76,383,632 (GRCm39) missense probably benign 0.17
R8980:Clock UTSW 5 76,402,286 (GRCm39) missense probably benign 0.01
R8982:Clock UTSW 5 76,364,559 (GRCm39) missense unknown
R9177:Clock UTSW 5 76,377,256 (GRCm39) missense probably benign 0.00
R9208:Clock UTSW 5 76,384,871 (GRCm39) missense probably benign 0.00
R9213:Clock UTSW 5 76,393,376 (GRCm39) missense possibly damaging 0.94
R9307:Clock UTSW 5 76,364,671 (GRCm39) missense unknown
R9446:Clock UTSW 5 76,396,288 (GRCm39) missense probably benign 0.00
R9516:Clock UTSW 5 76,377,227 (GRCm39) missense possibly damaging 0.85
R9572:Clock UTSW 5 76,377,338 (GRCm39) missense probably benign 0.00
R9630:Clock UTSW 5 76,393,281 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTCATTGTACATTGGAATAGATCTGG -3'
(R):5'- TGCATGTCCTCTGTTACTTAATAGC -3'

Sequencing Primer
(F):5'- ATATACACACATACACATATACACGC -3'
(R):5'- CAGTCTGATCTTGTGGATCAA -3'
Posted On 2019-10-24