Incidental Mutation 'R7640:Tmem132c'
ID 590182
Institutional Source Beutler Lab
Gene Symbol Tmem132c
Ensembl Gene ENSMUSG00000034324
Gene Name transmembrane protein 132C
Synonyms 2810482M11Rik, 4632425D07Rik
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.088) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 127318890-127642854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127640070 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 747 (D747G)
Ref Sequence ENSEMBL: ENSMUSP00000113090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119026]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000119026
AA Change: D747G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113090
Gene: ENSMUSG00000034324
AA Change: D747G

DomainStartEndE-ValueType
low complexity region 14 21 N/A INTRINSIC
Pfam:TMEM132D_N 58 187 1.2e-54 PFAM
Pfam:TMEM132 444 787 4.5e-143 PFAM
Pfam:TMEM132D_C 892 980 2.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145748
SMART Domains Protein: ENSMUSP00000121783
Gene: ENSMUSG00000034324

DomainStartEndE-ValueType
Pfam:TMEM132 1 112 6.2e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Atr T G 9: 95,789,346 (GRCm39) probably null Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Clock G T 5: 76,396,225 (GRCm39) L175M possibly damaging Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Cuta C T 17: 27,157,396 (GRCm39) V135I probably benign Het
Ddx41 A T 13: 55,682,052 (GRCm39) M241K possibly damaging Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Fas A G 19: 34,284,564 (GRCm39) T24A possibly damaging Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Lamc2 A T 1: 153,012,550 (GRCm39) I708N possibly damaging Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Muc4 C A 16: 32,580,479 (GRCm39) P360T Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or5w11 A G 2: 87,459,436 (GRCm39) I94V probably benign Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pmepa1 C T 2: 173,117,956 (GRCm39) A8T probably benign Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rpap1 G A 2: 119,594,891 (GRCm39) P1372L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sema3f A T 9: 107,560,774 (GRCm39) S644R probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tlcd4 A G 3: 121,028,690 (GRCm39) probably null Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp423 T C 8: 88,507,905 (GRCm39) K813R probably damaging Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Tmem132c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00869:Tmem132c APN 5 127,640,306 (GRCm39) missense possibly damaging 0.95
IGL00985:Tmem132c APN 5 127,581,930 (GRCm39) missense probably damaging 0.99
IGL01599:Tmem132c APN 5 127,436,616 (GRCm39) splice site probably benign
IGL01750:Tmem132c APN 5 127,540,023 (GRCm39) missense possibly damaging 0.91
IGL01893:Tmem132c APN 5 127,540,093 (GRCm39) missense possibly damaging 0.51
IGL02143:Tmem132c APN 5 127,640,466 (GRCm39) missense probably benign 0.03
IGL02164:Tmem132c APN 5 127,613,441 (GRCm39) missense probably damaging 1.00
IGL02252:Tmem132c APN 5 127,539,991 (GRCm39) missense possibly damaging 0.91
IGL02527:Tmem132c APN 5 127,436,675 (GRCm39) missense possibly damaging 0.95
IGL02584:Tmem132c APN 5 127,582,063 (GRCm39) missense probably damaging 1.00
IGL02878:Tmem132c APN 5 127,640,154 (GRCm39) missense probably damaging 0.99
IGL03065:Tmem132c APN 5 127,640,688 (GRCm39) missense probably damaging 1.00
IGL03120:Tmem132c APN 5 127,640,448 (GRCm39) missense probably benign 0.06
IGL03380:Tmem132c APN 5 127,613,506 (GRCm39) missense probably benign 0.00
IGL03387:Tmem132c APN 5 127,640,784 (GRCm39) missense probably benign 0.00
R0106:Tmem132c UTSW 5 127,631,733 (GRCm39) missense possibly damaging 0.94
R0106:Tmem132c UTSW 5 127,631,733 (GRCm39) missense possibly damaging 0.94
R0415:Tmem132c UTSW 5 127,640,769 (GRCm39) missense probably damaging 1.00
R0607:Tmem132c UTSW 5 127,640,617 (GRCm39) nonsense probably null
R1413:Tmem132c UTSW 5 127,640,631 (GRCm39) missense probably damaging 1.00
R1531:Tmem132c UTSW 5 127,436,955 (GRCm39) missense probably damaging 1.00
R1648:Tmem132c UTSW 5 127,540,120 (GRCm39) splice site probably benign
R2148:Tmem132c UTSW 5 127,540,026 (GRCm39) missense probably damaging 1.00
R2149:Tmem132c UTSW 5 127,540,026 (GRCm39) missense probably damaging 1.00
R2259:Tmem132c UTSW 5 127,581,988 (GRCm39) missense probably benign 0.01
R3853:Tmem132c UTSW 5 127,436,933 (GRCm39) missense probably benign 0.00
R4204:Tmem132c UTSW 5 127,640,829 (GRCm39) missense possibly damaging 0.73
R4543:Tmem132c UTSW 5 127,582,041 (GRCm39) missense probably benign 0.00
R4701:Tmem132c UTSW 5 127,641,560 (GRCm39) unclassified probably benign
R5017:Tmem132c UTSW 5 127,640,414 (GRCm39) missense probably benign 0.13
R5037:Tmem132c UTSW 5 127,630,199 (GRCm39) missense probably benign 0.42
R5327:Tmem132c UTSW 5 127,640,816 (GRCm39) missense possibly damaging 0.50
R5423:Tmem132c UTSW 5 127,640,907 (GRCm39) missense probably benign 0.02
R5548:Tmem132c UTSW 5 127,628,587 (GRCm39) nonsense probably null
R6425:Tmem132c UTSW 5 127,630,329 (GRCm39) missense possibly damaging 0.95
R6717:Tmem132c UTSW 5 127,641,093 (GRCm39) missense possibly damaging 0.93
R6899:Tmem132c UTSW 5 127,628,744 (GRCm39) missense probably damaging 1.00
R7007:Tmem132c UTSW 5 127,436,679 (GRCm39) missense probably damaging 1.00
R7297:Tmem132c UTSW 5 127,437,281 (GRCm39) missense probably benign 0.06
R7326:Tmem132c UTSW 5 127,641,123 (GRCm39) missense possibly damaging 0.51
R7386:Tmem132c UTSW 5 127,640,990 (GRCm39) missense probably benign 0.16
R7504:Tmem132c UTSW 5 127,631,696 (GRCm39) missense probably damaging 1.00
R7718:Tmem132c UTSW 5 127,640,504 (GRCm39) missense probably benign 0.06
R7762:Tmem132c UTSW 5 127,631,760 (GRCm39) missense possibly damaging 0.90
R7818:Tmem132c UTSW 5 127,641,152 (GRCm39) makesense probably null
R8117:Tmem132c UTSW 5 127,437,176 (GRCm39) missense probably benign 0.22
R8425:Tmem132c UTSW 5 127,641,421 (GRCm39) missense
R8749:Tmem132c UTSW 5 127,437,003 (GRCm39) missense possibly damaging 0.75
R8771:Tmem132c UTSW 5 127,437,192 (GRCm39) missense probably benign 0.00
R8798:Tmem132c UTSW 5 127,437,217 (GRCm39) nonsense probably null
R9372:Tmem132c UTSW 5 127,640,145 (GRCm39) missense probably damaging 1.00
X0067:Tmem132c UTSW 5 127,613,471 (GRCm39) missense possibly damaging 0.79
Z1088:Tmem132c UTSW 5 127,581,985 (GRCm39) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTGCTTCCCCAGTATGTTGG -3'
(R):5'- GCGTCATCCCATCCAAACTTG -3'

Sequencing Primer
(F):5'- CCCCAGTATGTTGGAACTAGATCAG -3'
(R):5'- AACTTGACCCCCACGTGG -3'
Posted On 2019-10-24