Incidental Mutation 'R7640:Ankrd42'
ID 590186
Institutional Source Beutler Lab
Gene Symbol Ankrd42
Ensembl Gene ENSMUSG00000041343
Gene Name ankyrin repeat domain 42
Synonyms 4933417L02Rik, Ikbn
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 92581723-92637142 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92619635 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 167 (S167P)
Ref Sequence ENSEMBL: ENSMUSP00000061208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056106] [ENSMUST00000118157] [ENSMUST00000126305] [ENSMUST00000138267] [ENSMUST00000207131] [ENSMUST00000207151]
AlphaFold Q3V096
Predicted Effect probably benign
Transcript: ENSMUST00000056106
AA Change: S167P

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000061208
Gene: ENSMUSG00000041343
AA Change: S167P

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 1.48e-3 SMART
ANK 158 187 2.11e2 SMART
ANK 191 220 9.78e-4 SMART
ANK 263 293 1.33e2 SMART
ANK 297 326 1.22e-4 SMART
coiled coil region 437 489 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118157
AA Change: S167P

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113767
Gene: ENSMUSG00000041343
AA Change: S167P

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 1.48e-3 SMART
ANK 158 187 2.11e2 SMART
ANK 191 220 9.78e-4 SMART
ANK 263 293 1.33e2 SMART
ANK 297 326 1.22e-4 SMART
coiled coil region 437 489 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126305
SMART Domains Protein: ENSMUSP00000123315
Gene: ENSMUSG00000041343

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 2.92e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000138267
AA Change: S167P

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000207131
AA Change: S167P

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000207151
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Abcb6 A T 1: 75,174,845 probably null Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Atr T G 9: 95,907,293 probably null Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Cnmd T A 14: 79,661,534 Y26F possibly damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
En2 A T 5: 28,170,166 K236* probably null Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
L2hgdh A T 12: 69,721,357 Y122* probably null Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mfap4 A G 11: 61,487,087 N118D probably damaging Het
Mknk2 T C 10: 80,668,566 S301G probably benign Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrc2 T A 11: 105,332,295 S455T possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Oas1b T C 5: 120,821,414 L288P probably damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1131 A G 2: 87,629,092 I94V probably benign Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Pmepa1 C T 2: 173,276,163 A8T probably benign Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rpap1 G A 2: 119,764,410 P1372L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sema3f A T 9: 107,683,575 S644R probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Specc1l T A 10: 75,257,869 N717K probably damaging Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zfp873 T C 10: 82,060,275 I280T possibly damaging Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in Ankrd42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ankrd42 APN 7 92584454 utr 3 prime probably benign
IGL01151:Ankrd42 APN 7 92605200 unclassified probably benign
IGL01444:Ankrd42 APN 7 92610585 missense probably damaging 0.96
IGL01933:Ankrd42 APN 7 92605285 missense probably benign
IGL03195:Ankrd42 APN 7 92591858 missense probably benign 0.33
IGL03397:Ankrd42 APN 7 92619554 missense probably damaging 1.00
R0128:Ankrd42 UTSW 7 92591859 nonsense probably null
R0278:Ankrd42 UTSW 7 92631657 missense possibly damaging 0.82
R0839:Ankrd42 UTSW 7 92612772 missense possibly damaging 0.92
R1227:Ankrd42 UTSW 7 92605300 missense possibly damaging 0.53
R1603:Ankrd42 UTSW 7 92619691 intron probably benign
R2281:Ankrd42 UTSW 7 92625773 nonsense probably null
R2299:Ankrd42 UTSW 7 92590254 missense probably benign 0.33
R2324:Ankrd42 UTSW 7 92623978 missense probably damaging 0.98
R2874:Ankrd42 UTSW 7 92605358 missense possibly damaging 0.71
R3940:Ankrd42 UTSW 7 92591788 splice site probably null
R4998:Ankrd42 UTSW 7 92624074 missense possibly damaging 0.71
R5579:Ankrd42 UTSW 7 92590182 missense possibly damaging 0.96
R5954:Ankrd42 UTSW 7 92623967 critical splice donor site probably null
R6140:Ankrd42 UTSW 7 92591828 splice site probably null
R6924:Ankrd42 UTSW 7 92582016 unclassified probably benign
R6944:Ankrd42 UTSW 7 92619547 critical splice donor site probably null
R7096:Ankrd42 UTSW 7 92591832 nonsense probably null
R7101:Ankrd42 UTSW 7 92631544 missense possibly damaging 0.53
R7155:Ankrd42 UTSW 7 92591933 missense possibly damaging 0.72
R7410:Ankrd42 UTSW 7 92610554 missense possibly damaging 0.93
R7500:Ankrd42 UTSW 7 92591872 missense probably benign 0.33
R7737:Ankrd42 UTSW 7 92605262 missense possibly damaging 0.53
R8669:Ankrd42 UTSW 7 92619673 missense possibly damaging 0.51
R8794:Ankrd42 UTSW 7 92614466 missense probably benign 0.32
R9646:Ankrd42 UTSW 7 92624049 missense possibly damaging 0.84
X0065:Ankrd42 UTSW 7 92610555 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCTGTGAAGAAATTACAGAATGGTGG -3'
(R):5'- TTCAGATCAATGGGTGTGGC -3'

Sequencing Primer
(F):5'- ACAGAATGGTGGGAGAGTTATGTTTC -3'
(R):5'- CCTTACCAATGGCAGGAAA -3'
Posted On 2019-10-24