Mutagenetix > Incidental Mutation

Incidental Mutation 'R7640:Otoa'

590188

Institutional Source

Beutler Lab

Gene Symbol

Otoa

Ensembl Gene

ENSMUSG00000034990

Gene Name

otoancorin

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7640 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121081650-121163097 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121145626 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 869 (E869G)

Ref Sequence

ENSEMBL: ENSMUSP00000044177 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047025] [ENSMUST00000163275]

AlphaFold

Q8K561

Predicted Effect

probably damaging
Transcript: ENSMUST00000047025
AA Change: E869G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044177
Gene: ENSMUSG00000034990
AA Change: E869G

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1072	1089	N/A	INTRINSIC
low complexity region	1124	1133	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163275

Predicted Effect

probably benign
Transcript: ENSMUST00000165409

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is specifically expressed in the inner ear, and is located at the interface between the apical surface of the inner ear sensory epithelia and their overlying acellular gels. It is prposed that this protein is involved in the attachment of the inner ear acellular gels to the apical surface of the underlying nonsensory cells. Mutations in this gene are associated with autosomal recessive deafness type 22 (DFNB22). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hearing loss, detachment of the tectorial membrane from the spiral limbus, abnormal tectorial membrane morphology, absence of Hensen's stripe and increased cochlear nerve coumpond action potential threshold. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	A	T	4: 137,454,594	N20I	probably damaging	Het
1700020D05Rik	T	A	19: 5,503,007	S249C	probably damaging	Het
4930558K02Rik	A	G	1: 161,957,149	S74P	probably benign	Het
4932415D10Rik	T	A	10: 82,294,656	N840I	probably damaging	Het
Abcb6	A	T	1: 75,174,845		probably null	Het
Adamts14	C	A	10: 61,246,057	A234S	probably benign	Het
Ankrd42	A	G	7: 92,619,635	S167P	probably benign	Het
Ap3m1	T	C	14: 21,038,175	I272V	probably benign	Het
Armt1	T	C	10: 4,453,572	F219S	probably damaging	Het
Atr	T	G	9: 95,907,293		probably null	Het
Cep72	G	A	13: 74,058,488	Q72*	probably null	Het
Clock	G	T	5: 76,248,378	L175M	possibly damaging	Het
Cnmd	T	A	14: 79,661,534	Y26F	possibly damaging	Het
Col6a6	A	T	9: 105,785,744	M198K	possibly damaging	Het
Cuta	C	T	17: 26,938,422	V135I	probably benign	Het
Ddx41	A	T	13: 55,534,239	M241K	possibly damaging	Het
Dnajc22	A	G	15: 99,101,114	N60S	probably damaging	Het
Drc3	A	G	11: 60,388,904	M432V	probably benign	Het
Eef1d	C	A	15: 75,902,707	G368C	probably damaging	Het
En2	A	T	5: 28,170,166	K236*	probably null	Het
Fas	A	G	19: 34,307,164	T24A	possibly damaging	Het
Gm13078	T	C	4: 143,726,706	V128A	probably benign	Het
Golga2	T	C	2: 32,306,239	V930A	probably benign	Het
Gprin2	G	T	14: 34,195,753	A20D	probably benign	Het
Ighv14-4	A	T	12: 114,176,444	C115*	probably null	Het
Impdh2	T	C	9: 108,565,181	Y459H	possibly damaging	Het
Klhdc7b	G	T	15: 89,387,260	V124L	possibly damaging	Het
L2hgdh	A	T	12: 69,721,357	Y122*	probably null	Het
Lamc2	A	T	1: 153,136,804	I708N	possibly damaging	Het
Large2	T	C	2: 92,374,705	M1V	probably null	Het
Lrit2	T	C	14: 37,072,124	W382R	probably damaging	Het
Mcee	T	A	7: 64,411,968	V173E	probably damaging	Het
Mcph1	T	A	8: 18,632,326	V493E	probably benign	Het
Mfap4	A	G	11: 61,487,087	N118D	probably damaging	Het
Mknk2	T	C	10: 80,668,566	S301G	probably benign	Het
Mlf1	G	A	3: 67,392,933	M94I	possibly damaging	Het
Mrc2	T	A	11: 105,332,295	S455T	possibly damaging	Het
Mrgprb5	T	G	7: 48,168,259	I243L	probably benign	Het
Muc4	C	A	16: 32,760,105	P360T		Het
Nat10	G	A	2: 103,743,090	A354V	probably damaging	Het
Nts	T	C	10: 102,490,304	Q7R	possibly damaging	Het
Oas1b	T	C	5: 120,821,414	L288P	probably damaging	Het
Olfr1076	A	G	2: 86,508,943	I161M	possibly damaging	Het
Olfr1131	A	G	2: 87,629,092	I94V	probably benign	Het
Olfr1196	T	A	2: 88,700,886	I148L	probably benign	Het
Olfr633	A	T	7: 103,946,943	I126F	probably damaging	Het
Pcdhac2	T	C	18: 37,144,525	L186P	probably damaging	Het
Plekhh2	A	G	17: 84,610,776	E1271G	possibly damaging	Het
Pmepa1	C	T	2: 173,276,163	A8T	probably benign	Het
Rc3h2	A	G	2: 37,377,849		probably null	Het
Rlf	T	A	4: 121,146,801	M1771L	possibly damaging	Het
Rpap1	G	A	2: 119,764,410	P1372L	possibly damaging	Het
Rragd	A	T	4: 32,983,527	D22V	probably benign	Het
Sema3f	A	T	9: 107,683,575	S644R	probably benign	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Specc1l	T	A	10: 75,257,869	N717K	probably damaging	Het
Sphkap	C	T	1: 83,278,928	D367N	possibly damaging	Het
Tbc1d21	C	T	9: 58,361,261	V272M	probably damaging	Het
Tmem132c	A	G	5: 127,563,006	D747G	probably damaging	Het
Tmem56	A	G	3: 121,235,041		probably null	Het
Trim2	C	A	3: 84,190,906	V372F	probably benign	Het
Ttc34	A	G	4: 154,861,384	T292A	probably benign	Het
Ube3b	A	G	5: 114,415,323	T919A	probably benign	Het
Wdr34	T	G	2: 30,031,768	D527A	probably benign	Het
Zfhx4	T	C	3: 5,412,480	I3385T	probably benign	Het
Zfp423	T	C	8: 87,781,277	K813R	probably damaging	Het
Zfp850	T	C	7: 27,989,209	T525A	probably benign	Het
Zfp873	T	C	10: 82,060,275	I280T	possibly damaging	Het
Zkscan7	A	G	9: 122,896,056	T697A	possibly damaging	Het

Other mutations in Otoa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01469:Otoa	APN	7	121155273	critical splice donor site	probably null
IGL01791:Otoa	APN	7	121155849	missense	probably benign	0.25
IGL01924:Otoa	APN	7	121105968	missense	probably damaging	0.99
IGL01953:Otoa	APN	7	121160325	splice site	probably null
IGL02121:Otoa	APN	7	121122024	missense	probably benign	0.06
IGL02303:Otoa	APN	7	121132924	critical splice donor site	probably null
IGL02390:Otoa	APN	7	121131367	missense	possibly damaging	0.84
IGL02591:Otoa	APN	7	121155830	missense	probably damaging	1.00
IGL02811:Otoa	APN	7	121118655	missense	possibly damaging	0.60
IGL02878:Otoa	APN	7	121143853	missense	probably damaging	1.00
IGL03328:Otoa	APN	7	121110994	missense	probably damaging	0.98
R0056:Otoa	UTSW	7	121131347	missense	probably benign	0.00
R0279:Otoa	UTSW	7	121111079	splice site	probably benign
R0390:Otoa	UTSW	7	121131341	missense	probably benign	0.07
R0411:Otoa	UTSW	7	121156527	critical splice donor site	probably null
R0628:Otoa	UTSW	7	121145650	splice site	probably benign
R1113:Otoa	UTSW	7	121125443	nonsense	probably null
R1240:Otoa	UTSW	7	121156490	missense	probably benign
R1308:Otoa	UTSW	7	121125443	nonsense	probably null
R1692:Otoa	UTSW	7	121091551	missense	probably damaging	0.99
R1728:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1729:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1744:Otoa	UTSW	7	121127776	splice site	probably benign
R1759:Otoa	UTSW	7	121134103	missense	probably damaging	1.00
R1784:Otoa	UTSW	7	121125439	missense	probably benign	0.36
R1817:Otoa	UTSW	7	121160530	utr 3 prime	probably benign
R1961:Otoa	UTSW	7	121118569	missense	probably benign	0.05
R2061:Otoa	UTSW	7	121131328	missense	probably damaging	1.00
R2509:Otoa	UTSW	7	121160472	missense	probably benign
R2510:Otoa	UTSW	7	121160472	missense	probably benign
R3411:Otoa	UTSW	7	121122043	missense	probably damaging	1.00
R3438:Otoa	UTSW	7	121160343	missense	possibly damaging	0.80
R3905:Otoa	UTSW	7	121125565	missense	probably damaging	1.00
R3907:Otoa	UTSW	7	121125565	missense	probably damaging	1.00
R4613:Otoa	UTSW	7	121145568	missense	probably damaging	1.00
R4751:Otoa	UTSW	7	121132924	critical splice donor site	probably benign
R4896:Otoa	UTSW	7	121102679	missense	probably damaging	1.00
R4932:Otoa	UTSW	7	121155135	missense	probably damaging	0.98
R5224:Otoa	UTSW	7	121139793	missense	probably damaging	0.98
R5235:Otoa	UTSW	7	121156470	missense	probably damaging	1.00
R5595:Otoa	UTSW	7	121121977	missense	probably damaging	1.00
R5891:Otoa	UTSW	7	121132360	splice site	probably null
R5894:Otoa	UTSW	7	121121869	missense	probably damaging	1.00
R5905:Otoa	UTSW	7	121094601	missense	probably damaging	1.00
R5976:Otoa	UTSW	7	121127713	missense	probably benign	0.00
R6464:Otoa	UTSW	7	121102605	missense	probably damaging	1.00
R6761:Otoa	UTSW	7	121121950	missense	probably damaging	1.00
R6770:Otoa	UTSW	7	121145614	missense	probably benign	0.25
R6821:Otoa	UTSW	7	121092847	critical splice donor site	probably null
R6924:Otoa	UTSW	7	121131501	splice site	probably null
R7016:Otoa	UTSW	7	121147766	missense	probably damaging	0.99
R7215:Otoa	UTSW	7	121118572	missense	unknown
R7313:Otoa	UTSW	7	121102542	missense	probably benign	0.42
R7340:Otoa	UTSW	7	121130065	missense	probably benign	0.38
R7443:Otoa	UTSW	7	121132410	missense	probably benign	0.00
R7559:Otoa	UTSW	7	121143926	missense	probably damaging	0.99
R7654:Otoa	UTSW	7	121147700	missense	probably damaging	1.00
R7659:Otoa	UTSW	7	121134044	missense	probably benign	0.01
R8421:Otoa	UTSW	7	121099268	critical splice donor site	probably null
R8799:Otoa	UTSW	7	121092671	missense	possibly damaging	0.56
R8954:Otoa	UTSW	7	121145518	nonsense	probably null
R9099:Otoa	UTSW	7	121139832	missense	probably benign
R9126:Otoa	UTSW	7	121094622	missense	probably damaging	1.00
R9369:Otoa	UTSW	7	121145617	missense	probably benign	0.23
U24488:Otoa	UTSW	7	121118540	critical splice acceptor site	probably null
X0023:Otoa	UTSW	7	121118571	missense	probably benign	0.00
Z1177:Otoa	UTSW	7	121118655	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACATCTGTCTGTGTTCCTCAGG -3'
(R):5'- ACATGCATCATCTGTGTTCTGC -3'

Sequencing Primer
(F):5'- CCTCAGGTTGTCATGGAGTTG -3'
(R):5'- AGGTACCAATAGTGTGCCCATTTC -3'

Posted On

2019-10-24