Incidental Mutation 'R7640:Specc1l'
ID 590197
Institutional Source Beutler Lab
Gene Symbol Specc1l
Ensembl Gene ENSMUSG00000033444
Gene Name sperm antigen with calponin homology and coiled-coil domains 1-like
Synonyms Cytsa, Specc1l
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.630) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 75212073-75312743 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75257869 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 717 (N717K)
Ref Sequence ENSEMBL: ENSMUSP00000151322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040105] [ENSMUST00000105421] [ENSMUST00000218766]
AlphaFold Q2KN98
Predicted Effect probably damaging
Transcript: ENSMUST00000040105
AA Change: N734K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045099
Gene: ENSMUSG00000033444
AA Change: N734K

DomainStartEndE-ValueType
low complexity region 97 107 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
coiled coil region 255 298 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
coiled coil region 412 467 N/A INTRINSIC
coiled coil region 505 825 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 989 1010 N/A INTRINSIC
CH 1031 1129 1.52e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105421
AA Change: N734K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101061
Gene: ENSMUSG00000033444
AA Change: N734K

DomainStartEndE-ValueType
low complexity region 80 90 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
coiled coil region 238 281 N/A INTRINSIC
low complexity region 359 373 N/A INTRINSIC
coiled coil region 395 450 N/A INTRINSIC
coiled coil region 488 808 N/A INTRINSIC
low complexity region 829 841 N/A INTRINSIC
low complexity region 972 993 N/A INTRINSIC
CH 1014 1112 1.52e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218766
AA Change: N717K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein. The encoded protein may play a critical role in actin-cytoskeletal reorganization during facial morphogenesis. Mutations in this gene are a cause of oblique facial clefting-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A read-through transcript composed of SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and the downstream ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous knockout affects cranial neural crest cell migration, which causes neural tube closure defects and leads to embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Abcb6 A T 1: 75,174,845 probably null Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ankrd42 A G 7: 92,619,635 S167P probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Atr T G 9: 95,907,293 probably null Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Cnmd T A 14: 79,661,534 Y26F possibly damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
En2 A T 5: 28,170,166 K236* probably null Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
L2hgdh A T 12: 69,721,357 Y122* probably null Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mfap4 A G 11: 61,487,087 N118D probably damaging Het
Mknk2 T C 10: 80,668,566 S301G probably benign Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrc2 T A 11: 105,332,295 S455T possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Oas1b T C 5: 120,821,414 L288P probably damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1131 A G 2: 87,629,092 I94V probably benign Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Pmepa1 C T 2: 173,276,163 A8T probably benign Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rpap1 G A 2: 119,764,410 P1372L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sema3f A T 9: 107,683,575 S644R probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zfp873 T C 10: 82,060,275 I280T possibly damaging Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in Specc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Specc1l APN 10 75246221 missense probably benign 0.12
IGL01638:Specc1l APN 10 75246205 nonsense probably null
IGL01970:Specc1l APN 10 75245761 missense probably damaging 1.00
IGL02539:Specc1l APN 10 75267508 missense probably benign 0.39
IGL02737:Specc1l APN 10 75246324 missense probably damaging 0.99
IGL02941:Specc1l APN 10 75241188 missense probably benign 0.10
R0305:Specc1l UTSW 10 75245829 missense probably damaging 1.00
R0374:Specc1l UTSW 10 75248459 missense probably damaging 0.99
R0402:Specc1l UTSW 10 75246426 missense probably damaging 1.00
R1456:Specc1l UTSW 10 75246284 missense probably damaging 0.98
R1508:Specc1l UTSW 10 75307238 missense probably benign 0.00
R1861:Specc1l UTSW 10 75309859 missense probably damaging 1.00
R1869:Specc1l UTSW 10 75261825 missense probably damaging 1.00
R1929:Specc1l UTSW 10 75245604 missense probably damaging 1.00
R1930:Specc1l UTSW 10 75309824 missense probably damaging 1.00
R2021:Specc1l UTSW 10 75267591 critical splice donor site probably null
R2209:Specc1l UTSW 10 75246576 missense probably damaging 1.00
R2271:Specc1l UTSW 10 75245604 missense probably damaging 1.00
R2937:Specc1l UTSW 10 75259131 missense probably damaging 0.98
R4415:Specc1l UTSW 10 75246328 missense possibly damaging 0.92
R4758:Specc1l UTSW 10 75246348 missense probably damaging 0.99
R5344:Specc1l UTSW 10 75246173 missense possibly damaging 0.84
R5383:Specc1l UTSW 10 75246705 missense possibly damaging 0.86
R5426:Specc1l UTSW 10 75267550 missense probably benign 0.21
R5774:Specc1l UTSW 10 75245400 missense probably damaging 1.00
R5788:Specc1l UTSW 10 75276921 missense probably damaging 1.00
R6101:Specc1l UTSW 10 75248632 missense probably damaging 1.00
R6105:Specc1l UTSW 10 75248632 missense probably damaging 1.00
R6136:Specc1l UTSW 10 75246660 missense probably benign 0.38
R6345:Specc1l UTSW 10 75248488 missense probably damaging 0.99
R6459:Specc1l UTSW 10 75246167 missense probably damaging 1.00
R6641:Specc1l UTSW 10 75246549 missense probably damaging 1.00
R6996:Specc1l UTSW 10 75246279 missense probably benign 0.23
R7100:Specc1l UTSW 10 75245495 missense probably benign 0.21
R7475:Specc1l UTSW 10 75246447 missense possibly damaging 0.59
R7545:Specc1l UTSW 10 75245087 missense probably benign 0.00
R7615:Specc1l UTSW 10 75263286 missense probably benign 0.02
R7635:Specc1l UTSW 10 75276804 missense probably damaging 1.00
R7682:Specc1l UTSW 10 75245802 missense probably damaging 0.99
R7711:Specc1l UTSW 10 75230808 missense probably benign 0.02
R7742:Specc1l UTSW 10 75246417 missense probably benign 0.01
R7847:Specc1l UTSW 10 75309836 missense probably damaging 0.99
R8015:Specc1l UTSW 10 75241068 missense probably benign 0.17
R8030:Specc1l UTSW 10 75248555 missense probably damaging 1.00
R8882:Specc1l UTSW 10 75229855 start codon destroyed unknown
R9069:Specc1l UTSW 10 75230806 missense probably benign 0.03
R9790:Specc1l UTSW 10 75230769 missense probably benign 0.21
R9791:Specc1l UTSW 10 75230769 missense probably benign 0.21
X0021:Specc1l UTSW 10 75274040 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTTCCAACAATTGCTTCCAG -3'
(R):5'- GTGTGGCTGATATCCTACCCTATC -3'

Sequencing Primer
(F):5'- ATGATGCAGAAACTGTAGTCTTGG -3'
(R):5'- GGCTGATATCCTACCCTATCTACAG -3'
Posted On 2019-10-24