Incidental Mutation 'R7640:Zfp873'
ID 590199
Institutional Source Beutler Lab
Gene Symbol Zfp873
Ensembl Gene ENSMUSG00000061371
Gene Name zinc finger protein 873
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 82048123-82064745 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82060275 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 280 (I280T)
Ref Sequence ENSEMBL: ENSMUSP00000100950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105313] [ENSMUST00000209622] [ENSMUST00000210325]
AlphaFold A0A1B0GT64
Predicted Effect possibly damaging
Transcript: ENSMUST00000105313
AA Change: I280T

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100950
Gene: ENSMUSG00000061371
AA Change: I280T

DomainStartEndE-ValueType
ZnF_C2H2 68 90 1.12e2 SMART
ZnF_C2H2 96 117 4.69e0 SMART
ZnF_C2H2 123 145 2.06e1 SMART
ZnF_C2H2 151 173 5.5e-3 SMART
ZnF_C2H2 179 201 3.69e-4 SMART
ZnF_C2H2 207 229 3.89e-3 SMART
ZnF_C2H2 235 257 9.88e-5 SMART
ZnF_C2H2 263 285 5.59e-4 SMART
ZnF_C2H2 291 313 2.99e-4 SMART
ZnF_C2H2 319 341 1.95e-3 SMART
ZnF_C2H2 347 369 2.75e-3 SMART
ZnF_C2H2 375 397 7.37e-4 SMART
ZnF_C2H2 403 425 2.53e-2 SMART
ZnF_C2H2 431 453 9.08e-4 SMART
ZnF_C2H2 459 481 5.99e-4 SMART
ZnF_C2H2 487 509 1.22e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.53e-2 SMART
ZnF_C2H2 571 593 9.73e-4 SMART
ZnF_C2H2 599 619 3.13e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209622
Predicted Effect probably benign
Transcript: ENSMUST00000210325
AA Change: I317T

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Abcb6 A T 1: 75,174,845 probably null Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ankrd42 A G 7: 92,619,635 S167P probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Atr T G 9: 95,907,293 probably null Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Cnmd T A 14: 79,661,534 Y26F possibly damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
En2 A T 5: 28,170,166 K236* probably null Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
L2hgdh A T 12: 69,721,357 Y122* probably null Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mfap4 A G 11: 61,487,087 N118D probably damaging Het
Mknk2 T C 10: 80,668,566 S301G probably benign Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrc2 T A 11: 105,332,295 S455T possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Oas1b T C 5: 120,821,414 L288P probably damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1131 A G 2: 87,629,092 I94V probably benign Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Pmepa1 C T 2: 173,276,163 A8T probably benign Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rpap1 G A 2: 119,764,410 P1372L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sema3f A T 9: 107,683,575 S644R probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Specc1l T A 10: 75,257,869 N717K probably damaging Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in Zfp873
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02250:Zfp873 APN 10 82058418 start codon destroyed probably null 0.45
G1Funyon:Zfp873 UTSW 10 82060879 missense probably damaging 1.00
R0666:Zfp873 UTSW 10 82060761 missense possibly damaging 0.75
R1568:Zfp873 UTSW 10 82060279 missense probably damaging 1.00
R1739:Zfp873 UTSW 10 82060707 missense probably damaging 1.00
R1848:Zfp873 UTSW 10 82060572 missense probably benign 0.33
R1892:Zfp873 UTSW 10 82061246 missense probably damaging 1.00
R2061:Zfp873 UTSW 10 82060157 missense probably benign 0.01
R3735:Zfp873 UTSW 10 82061181 missense probably benign 0.15
R4422:Zfp873 UTSW 10 82060874 missense probably benign 0.13
R4674:Zfp873 UTSW 10 82059980 missense possibly damaging 0.53
R4839:Zfp873 UTSW 10 82060519 missense probably damaging 0.98
R5146:Zfp873 UTSW 10 82060224 missense probably damaging 1.00
R5154:Zfp873 UTSW 10 82060191 missense possibly damaging 0.54
R5160:Zfp873 UTSW 10 82061042 missense possibly damaging 0.54
R5811:Zfp873 UTSW 10 82060733 missense probably damaging 1.00
R6625:Zfp873 UTSW 10 82060304 missense probably damaging 1.00
R6667:Zfp873 UTSW 10 82060589 missense probably benign 0.22
R6742:Zfp873 UTSW 10 82058422 missense probably damaging 1.00
R6878:Zfp873 UTSW 10 82060695 missense probably benign 0.33
R7055:Zfp873 UTSW 10 82059998 missense probably damaging 1.00
R7296:Zfp873 UTSW 10 82061237 missense probably damaging 1.00
R7381:Zfp873 UTSW 10 82060971 missense probably damaging 1.00
R7448:Zfp873 UTSW 10 82060627 missense probably damaging 1.00
R7464:Zfp873 UTSW 10 82060376 missense possibly damaging 0.51
R7470:Zfp873 UTSW 10 82059939 missense probably benign 0.19
R7862:Zfp873 UTSW 10 82060275 missense probably benign 0.03
R8017:Zfp873 UTSW 10 82060359 missense probably benign 0.01
R8301:Zfp873 UTSW 10 82060879 missense probably damaging 1.00
R8765:Zfp873 UTSW 10 82060238 missense probably damaging 1.00
R8997:Zfp873 UTSW 10 82061156 missense probably benign 0.03
R9305:Zfp873 UTSW 10 82060680 missense probably benign 0.00
R9462:Zfp873 UTSW 10 82061297 missense probably benign 0.31
Z1177:Zfp873 UTSW 10 82061165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTAGTAAAGCCTTTGCAAATTTCT -3'
(R):5'- CTTTCCCACACTGACTGCAA -3'

Sequencing Primer
(F):5'- GCCTTTGCAAATTTCTATAGTCTTCG -3'
(R):5'- GACTGCAACAATAGGGTTTCTGTCC -3'
Posted On 2019-10-24