Incidental Mutation 'R0234:Slc4a4'
ID59020
Institutional Source Beutler Lab
Gene Symbol Slc4a4
Ensembl Gene ENSMUSG00000060961
Gene Namesolute carrier family 4 (anion exchanger), member 4
SynonymsNBC1, NBC
MMRRC Submission 038475-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0234 (G1)
Quality Score176
Status Not validated
Chromosome5
Chromosomal Location88886818-89239653 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89156336 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 502 (H502P)
Ref Sequence ENSEMBL: ENSMUSP00000118413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113218] [ENSMUST00000130041] [ENSMUST00000148750] [ENSMUST00000156238]
Predicted Effect probably benign
Transcript: ENSMUST00000113218
AA Change: H537P

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108844
Gene: ENSMUSG00000060961
AA Change: H537P

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 379 1.1e-100 PFAM
low complexity region 408 423 N/A INTRINSIC
Pfam:HCO3_cotransp 426 947 3e-246 PFAM
transmembrane domain 953 975 N/A INTRINSIC
low complexity region 999 1015 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130041
AA Change: H502P

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118413
Gene: ENSMUSG00000060961
AA Change: H502P

DomainStartEndE-ValueType
Pfam:Band_3_cyto 93 344 1.5e-101 PFAM
low complexity region 373 388 N/A INTRINSIC
Pfam:HCO3_cotransp 391 912 2.7e-246 PFAM
transmembrane domain 918 940 N/A INTRINSIC
low complexity region 964 980 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148750
AA Change: H546P

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119325
Gene: ENSMUSG00000060961
AA Change: H546P

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 3.7e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 435 956 7.3e-246 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156238
AA Change: H546P

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121744
Gene: ENSMUSG00000060961
AA Change: H546P

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
Pfam:Band_3_cyto 137 388 4.6e-101 PFAM
low complexity region 417 432 N/A INTRINSIC
Pfam:HCO3_cotransp 436 956 4.1e-231 PFAM
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1008 1024 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium bicarbonate cotransporter (NBC) involved in the regulation of bicarbonate secretion and absorption and intracellular pH. Mutations in this gene are associated with proximal renal tubular acidosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit smaller birth size, growth retardation, postnatal lethality, bowel obstructions, altered blood chemistry, acidosis, spleen defects and defects in ion homeostasis. Heterozygotes have decreased levels of circulating bicarbonate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,194,303 probably null Het
A3galt2 A G 4: 128,767,148 R197G possibly damaging Het
Acacb A T 5: 114,209,817 H983L probably damaging Het
Adal T A 2: 121,148,317 D139E probably benign Het
Adam6b G A 12: 113,490,610 R349H probably damaging Het
Agap1 A G 1: 89,671,212 K331E probably damaging Het
Alyref T C 11: 120,598,307 D11G probably damaging Het
B3gat1 A G 9: 26,756,081 E203G probably damaging Het
Bsn T C 9: 108,116,396 E719G possibly damaging Het
Cap2 G C 13: 46,638,022 probably null Het
Ccni A G 5: 93,202,327 V31A probably benign Het
Cfap54 A T 10: 92,899,160 L2343* probably null Het
Clns1a T A 7: 97,714,032 Y204N possibly damaging Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
D430042O09Rik T C 7: 125,795,385 V211A probably benign Het
Dsp A G 13: 38,187,893 N940S probably benign Het
Erbb2 T C 11: 98,436,439 V1181A probably benign Het
Exoc4 T C 6: 33,862,087 V686A possibly damaging Het
F830045P16Rik A G 2: 129,463,464 V330A possibly damaging Het
Fam71a T C 1: 191,162,908 S513G probably benign Het
Fbf1 A C 11: 116,155,034 F245V probably damaging Het
Fut10 T A 8: 31,236,197 F327I probably damaging Het
Galnt1 C T 18: 24,254,633 P144S probably damaging Het
Ghrhr A T 6: 55,379,186 D88V possibly damaging Het
Greb1l T A 18: 10,560,331 C1864S probably damaging Het
Hist1h1c T C 13: 23,739,123 I92T probably benign Het
Hps1 T C 19: 42,762,553 E336G probably damaging Het
Ibsp GGAAGAAGAAGAAGAAGA GGAAGAAGAAGAAGA 5: 104,310,069 probably benign Het
Irgc1 C A 7: 24,433,328 E21D possibly damaging Het
Itsn1 A T 16: 91,828,280 R590* probably null Het
Lmln T C 16: 33,066,324 V67A probably damaging Het
Lsm14a T C 7: 34,365,617 Q179R probably damaging Het
Ltbr A C 6: 125,312,873 D119E probably benign Het
Mrc1 A G 2: 14,279,894 T565A possibly damaging Het
Muc6 A C 7: 141,649,674 N473K possibly damaging Het
Myocd A T 11: 65,187,240 D448E probably benign Het
Neil2 T A 14: 63,183,526 I239F probably damaging Het
Npnt A G 3: 132,914,414 F123S possibly damaging Het
Olfr1164 T A 2: 88,093,022 R305* probably null Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Olfr1309 T C 2: 111,983,300 Y258C probably damaging Het
Olfr1501 C T 19: 13,838,538 V212M possibly damaging Het
Olfr683 T C 7: 105,144,074 D73G probably damaging Het
Olfr686 C A 7: 105,203,614 C243F probably damaging Het
Olfr933 A C 9: 38,976,251 probably null Het
Pcnx3 T C 19: 5,672,618 T941A probably benign Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pitrm1 C A 13: 6,575,079 Y864* probably null Het
Plcb4 T C 2: 135,982,075 I844T probably benign Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Ppp1r3b T A 8: 35,384,501 F165I probably damaging Het
Prr5 T A 15: 84,703,121 F357L probably damaging Het
Rasgrf1 A T 9: 90,009,366 I1046F probably damaging Het
Rbm15b T C 9: 106,885,364 Y535C probably damaging Het
Rbp3 A T 14: 33,955,901 E602V probably damaging Het
Rimklb T C 6: 122,456,333 N343S probably benign Het
Rrp12 A G 19: 41,871,760 L1008P probably damaging Het
Sec63 C T 10: 42,798,798 R226C probably damaging Het
Sirpa T C 2: 129,615,468 V154A probably damaging Het
Slc13a5 C G 11: 72,250,800 V405L probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a23 G A 13: 34,183,261 T588I probably damaging Het
Slc22a27 C A 19: 7,926,791 probably benign Het
Slc5a5 A T 8: 70,889,633 M258K probably damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Stk11ip A G 1: 75,529,067 D460G possibly damaging Het
Syn3 T A 10: 86,448,886 I117F possibly damaging Het
Tead4 C T 6: 128,243,402 A224T probably damaging Het
Tmtc3 A T 10: 100,450,322 N546K probably benign Het
Tnn T A 1: 160,088,466 H1227L probably damaging Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Trf T C 9: 103,226,879 probably null Het
Ubr5 T C 15: 37,968,493 T2727A probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Wipf3 T G 6: 54,496,501 L458R probably damaging Het
Zfp236 T C 18: 82,629,994 K966R probably damaging Het
Zfp27 T A 7: 29,894,107 H811L possibly damaging Het
Zfp366 A G 13: 99,234,260 H496R probably damaging Het
Zfp467 A T 6: 48,438,755 V321E probably damaging Het
Other mutations in Slc4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Slc4a4 APN 5 89179686 missense probably benign 0.01
IGL00976:Slc4a4 APN 5 88954798 missense probably damaging 1.00
IGL01074:Slc4a4 APN 5 89179774 missense probably damaging 1.00
IGL01120:Slc4a4 APN 5 89132379 missense probably damaging 1.00
IGL01284:Slc4a4 APN 5 89129673 missense probably benign 0.22
IGL01375:Slc4a4 APN 5 89179734 missense probably damaging 1.00
IGL01399:Slc4a4 APN 5 89228935 missense probably damaging 1.00
IGL01487:Slc4a4 APN 5 89228856 missense probably benign 0.19
IGL02501:Slc4a4 APN 5 89129649 missense probably benign 0.13
IGL03104:Slc4a4 APN 5 89149372 missense probably damaging 1.00
IGL03157:Slc4a4 APN 5 89156513 missense probably damaging 0.99
IGL03205:Slc4a4 APN 5 89149330 missense probably benign 0.00
IGL03356:Slc4a4 APN 5 89122483 missense probably benign 0.00
IGL03372:Slc4a4 APN 5 89156426 missense probably damaging 1.00
IGL03382:Slc4a4 APN 5 89228836 missense probably damaging 1.00
camera UTSW 5 89132507 missense probably damaging 1.00
pixels UTSW 5 89122403 missense probably damaging 0.99
Shutter UTSW 5 89225948 missense probably damaging 1.00
Tetrapod UTSW 5 89228972 missense probably damaging 1.00
tripod UTSW 5 89149333 missense possibly damaging 0.52
PIT4515001:Slc4a4 UTSW 5 89133253 missense probably damaging 1.00
PIT4544001:Slc4a4 UTSW 5 89038543 missense probably damaging 1.00
R0007:Slc4a4 UTSW 5 89038578 missense probably damaging 1.00
R0052:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0052:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0054:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0055:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0230:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0234:Slc4a4 UTSW 5 89156336 missense possibly damaging 0.71
R0632:Slc4a4 UTSW 5 89129641 missense probably damaging 1.00
R1199:Slc4a4 UTSW 5 89215794 critical splice donor site probably null
R1597:Slc4a4 UTSW 5 89135728 missense probably benign 0.01
R1783:Slc4a4 UTSW 5 89132414 missense probably damaging 1.00
R1813:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R1896:Slc4a4 UTSW 5 89046308 missense probably damaging 0.98
R2000:Slc4a4 UTSW 5 89028347 missense probably damaging 1.00
R2139:Slc4a4 UTSW 5 89046264 missense probably damaging 1.00
R2163:Slc4a4 UTSW 5 89214576 missense probably damaging 1.00
R2513:Slc4a4 UTSW 5 89156398 missense probably benign 0.00
R2873:Slc4a4 UTSW 5 89135764 missense probably damaging 1.00
R2995:Slc4a4 UTSW 5 88934814 missense probably damaging 1.00
R3054:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89132507 missense probably damaging 1.00
R3055:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3056:Slc4a4 UTSW 5 89225948 missense probably damaging 1.00
R3617:Slc4a4 UTSW 5 89234804 missense probably benign 0.00
R3856:Slc4a4 UTSW 5 89232839 missense probably benign 0.00
R3863:Slc4a4 UTSW 5 89135648 missense possibly damaging 0.95
R3896:Slc4a4 UTSW 5 89197766 splice site probably benign
R4007:Slc4a4 UTSW 5 89214593 missense probably damaging 1.00
R4616:Slc4a4 UTSW 5 89038561 missense probably damaging 1.00
R4740:Slc4a4 UTSW 5 89225894 missense probably damaging 1.00
R5009:Slc4a4 UTSW 5 89149298 critical splice acceptor site probably null
R5119:Slc4a4 UTSW 5 88954862 missense probably null 0.97
R5228:Slc4a4 UTSW 5 89156525 missense possibly damaging 0.50
R5394:Slc4a4 UTSW 5 89197764 critical splice donor site probably null
R5396:Slc4a4 UTSW 5 89046217 missense probably benign 0.00
R5662:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R5664:Slc4a4 UTSW 5 89028244 missense probably damaging 0.96
R6021:Slc4a4 UTSW 5 89040402 intron probably benign
R6088:Slc4a4 UTSW 5 89197704 missense probably benign 0.12
R6337:Slc4a4 UTSW 5 89046372 missense probably benign 0.21
R6416:Slc4a4 UTSW 5 89179729 missense probably benign 0.26
R6452:Slc4a4 UTSW 5 89228980 missense probably benign 0.05
R6524:Slc4a4 UTSW 5 89232764 missense probably benign 0.01
R6566:Slc4a4 UTSW 5 89149333 missense possibly damaging 0.52
R6727:Slc4a4 UTSW 5 89170765 missense probably benign 0.00
R6844:Slc4a4 UTSW 5 89228972 missense probably damaging 1.00
R6970:Slc4a4 UTSW 5 89179831 missense probably damaging 0.98
R7021:Slc4a4 UTSW 5 89040346 splice site probably null
R7180:Slc4a4 UTSW 5 89046236 missense probably damaging 0.97
R7197:Slc4a4 UTSW 5 88934574 intron probably benign
R7246:Slc4a4 UTSW 5 89122403 missense probably damaging 0.99
R7309:Slc4a4 UTSW 5 89170751 missense probably benign
R7412:Slc4a4 UTSW 5 89214647 synonymous probably null
R7492:Slc4a4 UTSW 5 89129650 missense possibly damaging 0.92
R7561:Slc4a4 UTSW 5 89199697 missense probably damaging 1.00
R7577:Slc4a4 UTSW 5 89225867 missense probably damaging 0.97
R7609:Slc4a4 UTSW 5 89135686 missense probably damaging 1.00
R7781:Slc4a4 UTSW 5 89228932 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- gcttccacctcagAAGTTATTATTGAAAGCA -3'
(R):5'- GCTCACCAGAATTAAACTAAAAGGTCCCA -3'

Sequencing Primer
(F):5'- TTGAAAGCAATAATTAGTGACCCCC -3'
(R):5'- TGTACTGCAACTGTGCAAAC -3'
Posted On2013-07-11