Mutagenetix > Incidental Mutation

Incidental Mutation 'R7640:Nts'

590201

Institutional Source

Beutler Lab

Gene Symbol

Nts

Ensembl Gene

ENSMUSG00000019890

Gene Name

neurotensin

Synonyms

neuromedin N, NTS1, NMN-125, 5033428E16Rik, NT/N

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7640 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102481756-102490486 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102490304 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 7 (Q7R)

Ref Sequence

ENSEMBL: ENSMUSP00000020040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020040]

AlphaFold

Q9D3P9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020040
AA Change: Q7R

PolyPhen 2 Score 0.742 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000020040
Gene: ENSMUSG00000019890
AA Change: Q7R

Domain	Start	End	E-Value	Type
Pfam:Pro-NT_NN	3	169	2.4e-77	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a common precursor for two peptides, neuromedin N and neurotensin. Neurotensin is a secreted tridecapeptide, which is widely distributed throughout the central nervous system, and may function as a neurotransmitter or a neuromodulator. It may be involved in dopamine-associated pathophysiological events, in the maintenance of gut structure and function, and in the regulation of fat metabolism. Neurotensin also exhibits antimicrobial activity against bacteria and fungi. Tissue-specific processing may lead to the formation in some tissues of larger forms of neuromedin N and neurotensin. The large forms may represent more stable peptides that are also biologically active. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile, and grossly normal, but display altered responses to antipsychotic drugs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	A	T	4: 137,454,594	N20I	probably damaging	Het
1700020D05Rik	T	A	19: 5,503,007	S249C	probably damaging	Het
4930558K02Rik	A	G	1: 161,957,149	S74P	probably benign	Het
4932415D10Rik	T	A	10: 82,294,656	N840I	probably damaging	Het
Abcb6	A	T	1: 75,174,845		probably null	Het
Adamts14	C	A	10: 61,246,057	A234S	probably benign	Het
Ankrd42	A	G	7: 92,619,635	S167P	probably benign	Het
Ap3m1	T	C	14: 21,038,175	I272V	probably benign	Het
Armt1	T	C	10: 4,453,572	F219S	probably damaging	Het
Atr	T	G	9: 95,907,293		probably null	Het
Cep72	G	A	13: 74,058,488	Q72*	probably null	Het
Clock	G	T	5: 76,248,378	L175M	possibly damaging	Het
Cnmd	T	A	14: 79,661,534	Y26F	possibly damaging	Het
Col6a6	A	T	9: 105,785,744	M198K	possibly damaging	Het
Cuta	C	T	17: 26,938,422	V135I	probably benign	Het
Ddx41	A	T	13: 55,534,239	M241K	possibly damaging	Het
Dnajc22	A	G	15: 99,101,114	N60S	probably damaging	Het
Drc3	A	G	11: 60,388,904	M432V	probably benign	Het
Eef1d	C	A	15: 75,902,707	G368C	probably damaging	Het
En2	A	T	5: 28,170,166	K236*	probably null	Het
Fas	A	G	19: 34,307,164	T24A	possibly damaging	Het
Gm13078	T	C	4: 143,726,706	V128A	probably benign	Het
Golga2	T	C	2: 32,306,239	V930A	probably benign	Het
Gprin2	G	T	14: 34,195,753	A20D	probably benign	Het
Ighv14-4	A	T	12: 114,176,444	C115*	probably null	Het
Impdh2	T	C	9: 108,565,181	Y459H	possibly damaging	Het
Klhdc7b	G	T	15: 89,387,260	V124L	possibly damaging	Het
L2hgdh	A	T	12: 69,721,357	Y122*	probably null	Het
Lamc2	A	T	1: 153,136,804	I708N	possibly damaging	Het
Large2	T	C	2: 92,374,705	M1V	probably null	Het
Lrit2	T	C	14: 37,072,124	W382R	probably damaging	Het
Mcee	T	A	7: 64,411,968	V173E	probably damaging	Het
Mcph1	T	A	8: 18,632,326	V493E	probably benign	Het
Mfap4	A	G	11: 61,487,087	N118D	probably damaging	Het
Mknk2	T	C	10: 80,668,566	S301G	probably benign	Het
Mlf1	G	A	3: 67,392,933	M94I	possibly damaging	Het
Mrc2	T	A	11: 105,332,295	S455T	possibly damaging	Het
Mrgprb5	T	G	7: 48,168,259	I243L	probably benign	Het
Muc4	C	A	16: 32,760,105	P360T		Het
Nat10	G	A	2: 103,743,090	A354V	probably damaging	Het
Oas1b	T	C	5: 120,821,414	L288P	probably damaging	Het
Olfr1076	A	G	2: 86,508,943	I161M	possibly damaging	Het
Olfr1131	A	G	2: 87,629,092	I94V	probably benign	Het
Olfr1196	T	A	2: 88,700,886	I148L	probably benign	Het
Olfr633	A	T	7: 103,946,943	I126F	probably damaging	Het
Otoa	A	G	7: 121,145,626	E869G	probably damaging	Het
Pcdhac2	T	C	18: 37,144,525	L186P	probably damaging	Het
Plekhh2	A	G	17: 84,610,776	E1271G	possibly damaging	Het
Pmepa1	C	T	2: 173,276,163	A8T	probably benign	Het
Rc3h2	A	G	2: 37,377,849		probably null	Het
Rlf	T	A	4: 121,146,801	M1771L	possibly damaging	Het
Rpap1	G	A	2: 119,764,410	P1372L	possibly damaging	Het
Rragd	A	T	4: 32,983,527	D22V	probably benign	Het
Sema3f	A	T	9: 107,683,575	S644R	probably benign	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Specc1l	T	A	10: 75,257,869	N717K	probably damaging	Het
Sphkap	C	T	1: 83,278,928	D367N	possibly damaging	Het
Tbc1d21	C	T	9: 58,361,261	V272M	probably damaging	Het
Tmem132c	A	G	5: 127,563,006	D747G	probably damaging	Het
Tmem56	A	G	3: 121,235,041		probably null	Het
Trim2	C	A	3: 84,190,906	V372F	probably benign	Het
Ttc34	A	G	4: 154,861,384	T292A	probably benign	Het
Ube3b	A	G	5: 114,415,323	T919A	probably benign	Het
Wdr34	T	G	2: 30,031,768	D527A	probably benign	Het
Zfhx4	T	C	3: 5,412,480	I3385T	probably benign	Het
Zfp423	T	C	8: 87,781,277	K813R	probably damaging	Het
Zfp850	T	C	7: 27,989,209	T525A	probably benign	Het
Zfp873	T	C	10: 82,060,275	I280T	possibly damaging	Het
Zkscan7	A	G	9: 122,896,056	T697A	possibly damaging	Het

Other mutations in Nts

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02475:Nts	APN	10	102490247	splice site	probably benign
IGL02585:Nts	APN	10	102482468	missense	probably benign	0.01
IGL02838:Nts	APN	10	102482429	missense	probably damaging	0.98
R1962:Nts	UTSW	10	102485057	missense	probably damaging	1.00
R4433:Nts	UTSW	10	102485027	missense	probably benign	0.00
R6063:Nts	UTSW	10	102484995	missense	probably benign	0.25
R6735:Nts	UTSW	10	102484998	missense	probably benign
R7723:Nts	UTSW	10	102484923	missense	probably damaging	1.00
R8458:Nts	UTSW	10	102485060	missense	probably damaging	0.98
R8886:Nts	UTSW	10	102485007	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCTTGCACCATGAACTGC -3'
(R):5'- GCCATGACATCATCCTCCTG -3'

Sequencing Primer
(F):5'- CAGTTCTTATAATCAGAATGGGAGAG -3'
(R):5'- GCTCACATATATATAGGGACTGGCC -3'

Posted On

2019-10-24