Incidental Mutation 'R7640:Mfap4'
ID 590203
Institutional Source Beutler Lab
Gene Symbol Mfap4
Ensembl Gene ENSMUSG00000042436
Gene Name microfibrillar-associated protein 4
Synonyms 1110007F23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 61485431-61488900 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61487087 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 118 (N118D)
Ref Sequence ENSEMBL: ENSMUSP00000070848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040522] [ENSMUST00000064783] [ENSMUST00000079080] [ENSMUST00000101085] [ENSMUST00000108714] [ENSMUST00000153441]
AlphaFold Q9D1H9
Predicted Effect probably damaging
Transcript: ENSMUST00000040522
AA Change: N142D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038971
Gene: ENSMUSG00000042436
AA Change: N142D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 280 5.6e-119 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064783
AA Change: N118D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070848
Gene: ENSMUSG00000042436
AA Change: N118D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 257 3.39e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079080
SMART Domains Protein: ENSMUSP00000078087
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 55 347 5.66e-96 SMART
low complexity region 433 447 N/A INTRINSIC
low complexity region 476 492 N/A INTRINSIC
coiled coil region 508 544 N/A INTRINSIC
low complexity region 578 603 N/A INTRINSIC
low complexity region 620 644 N/A INTRINSIC
low complexity region 675 692 N/A INTRINSIC
low complexity region 758 772 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101085
SMART Domains Protein: ENSMUSP00000098646
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
S_TKc 4 277 3.48e-73 SMART
low complexity region 363 377 N/A INTRINSIC
coiled coil region 405 441 N/A INTRINSIC
low complexity region 475 500 N/A INTRINSIC
low complexity region 517 541 N/A INTRINSIC
low complexity region 572 589 N/A INTRINSIC
low complexity region 655 669 N/A INTRINSIC
low complexity region 688 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108714
SMART Domains Protein: ENSMUSP00000104354
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
S_TKc 1 278 1.76e-74 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 407 423 N/A INTRINSIC
coiled coil region 439 475 N/A INTRINSIC
low complexity region 509 534 N/A INTRINSIC
low complexity region 551 575 N/A INTRINSIC
low complexity region 606 623 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153441
SMART Domains Protein: ENSMUSP00000116084
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
PDB:4IC8|B 1 49 2e-26 PDB
low complexity region 51 65 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
coiled coil region 126 162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to a bovine microfibril-associated protein. The protein has binding specificities for both collagen and carbohydrate. It is thought to be an extracellular matrix protein which is involved in cell adhesion or intercellular interactions. The gene is located within the Smith-Magenis syndrome region. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spontaneous air space enlargement in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Abcb6 A T 1: 75,174,845 probably null Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ankrd42 A G 7: 92,619,635 S167P probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Atr T G 9: 95,907,293 probably null Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Cnmd T A 14: 79,661,534 Y26F possibly damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
En2 A T 5: 28,170,166 K236* probably null Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
L2hgdh A T 12: 69,721,357 Y122* probably null Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mknk2 T C 10: 80,668,566 S301G probably benign Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrc2 T A 11: 105,332,295 S455T possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Oas1b T C 5: 120,821,414 L288P probably damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1131 A G 2: 87,629,092 I94V probably benign Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Pmepa1 C T 2: 173,276,163 A8T probably benign Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rpap1 G A 2: 119,764,410 P1372L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sema3f A T 9: 107,683,575 S644R probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Specc1l T A 10: 75,257,869 N717K probably damaging Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zfp873 T C 10: 82,060,275 I280T possibly damaging Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in Mfap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Mfap4 APN 11 61487781 missense possibly damaging 0.94
IGL01482:Mfap4 APN 11 61487757 missense probably damaging 1.00
R0512:Mfap4 UTSW 11 61487945 missense probably damaging 1.00
R0631:Mfap4 UTSW 11 61487180 missense probably damaging 0.99
R1991:Mfap4 UTSW 11 61485807 critical splice donor site probably null
R2680:Mfap4 UTSW 11 61487231 missense probably benign 0.03
R4614:Mfap4 UTSW 11 61485509 unclassified probably benign
R4616:Mfap4 UTSW 11 61485509 unclassified probably benign
R4617:Mfap4 UTSW 11 61485509 unclassified probably benign
R4675:Mfap4 UTSW 11 61485510 unclassified probably benign
R4987:Mfap4 UTSW 11 61486082 missense probably benign 0.14
R5381:Mfap4 UTSW 11 61487930 missense probably benign 0.06
R6173:Mfap4 UTSW 11 61485419 splice site probably null
R7695:Mfap4 UTSW 11 61485719 critical splice acceptor site probably null
R9245:Mfap4 UTSW 11 61487181 missense probably damaging 1.00
R9558:Mfap4 UTSW 11 61486139 missense probably benign 0.02
R9681:Mfap4 UTSW 11 61486099 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAAAGATTCAACGGCTCAGTG -3'
(R):5'- AAGTTGAGAGAGGTACCCGC -3'

Sequencing Primer
(F):5'- AGATTCAACGGCTCAGTGAGTTTC -3'
(R):5'- ACTGCCCCTGAAGAAGCTGAG -3'
Posted On 2019-10-24