Incidental Mutation 'R7640:Mrc2'
ID590204
Institutional Source Beutler Lab
Gene Symbol Mrc2
Ensembl Gene ENSMUSG00000020695
Gene Namemannose receptor, C type 2
SynonymsEndo180, uPARAP, novel lectin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7640 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location105292643-105351139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105332295 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 455 (S455T)
Ref Sequence ENSEMBL: ENSMUSP00000097909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021038
AA Change: S455T

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695
AA Change: S455T

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100335
AA Change: S455T

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695
AA Change: S455T

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
RICIN 40 160 8.49e-12 SMART
FN2 179 227 4.83e-27 SMART
CLECT 234 359 1.15e-33 SMART
CLECT 381 504 1.47e-40 SMART
CLECT 520 644 6.82e-27 SMART
CLECT 668 808 2.71e-30 SMART
CLECT 824 950 6.77e-31 SMART
CLECT 971 1107 3.91e-36 SMART
CLECT 1124 1243 1.04e-17 SMART
CLECT 1259 1392 9.08e-23 SMART
transmembrane domain 1412 1434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ankrd42 A G 7: 92,619,635 S167P probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Cnmd T A 14: 79,661,534 Y26F possibly damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
En2 A T 5: 28,170,166 K236* probably null Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
L2hgdh A T 12: 69,721,357 Y122* probably null Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mfap4 A G 11: 61,487,087 N118D probably damaging Het
Mknk2 T C 10: 80,668,566 S301G probably benign Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1131 A G 2: 87,629,092 I94V probably benign Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Pmepa1 C T 2: 173,276,163 A8T probably benign Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rpap1 G A 2: 119,764,410 P1372L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Specc1l T A 10: 75,257,869 N717K probably damaging Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zfp873 T C 10: 82,060,275 I280T possibly damaging Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in Mrc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Mrc2 APN 11 105328741 missense probably damaging 0.96
IGL01374:Mrc2 APN 11 105347643 nonsense probably null
IGL01751:Mrc2 APN 11 105325734 missense probably benign 0.00
IGL01780:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL01835:Mrc2 APN 11 105336677 missense probably damaging 1.00
IGL02350:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02357:Mrc2 APN 11 105325721 missense probably damaging 1.00
IGL02829:Mrc2 APN 11 105336707 missense possibly damaging 0.85
IGL02863:Mrc2 APN 11 105333620 splice site probably benign
IGL02940:Mrc2 APN 11 105341171 missense probably damaging 1.00
IGL02988:Mrc2 UTSW 11 105325571 missense probably benign 0.04
R0254:Mrc2 UTSW 11 105347866 missense probably benign 0.00
R0634:Mrc2 UTSW 11 105347692 missense probably benign 0.01
R1102:Mrc2 UTSW 11 105340821 missense probably benign
R1233:Mrc2 UTSW 11 105348415 missense probably damaging 1.00
R1244:Mrc2 UTSW 11 105348431 splice site probably null
R1458:Mrc2 UTSW 11 105337772 missense probably benign 0.01
R1500:Mrc2 UTSW 11 105347725 missense probably damaging 1.00
R1573:Mrc2 UTSW 11 105336656 missense probably damaging 1.00
R1770:Mrc2 UTSW 11 105338793 missense probably damaging 0.99
R1842:Mrc2 UTSW 11 105337720 missense probably damaging 0.98
R2156:Mrc2 UTSW 11 105347856 splice site probably null
R2165:Mrc2 UTSW 11 105348431 splice site probably null
R2265:Mrc2 UTSW 11 105348431 splice site probably null
R2266:Mrc2 UTSW 11 105348431 splice site probably null
R2267:Mrc2 UTSW 11 105348431 splice site probably null
R2268:Mrc2 UTSW 11 105348431 splice site probably null
R2269:Mrc2 UTSW 11 105348431 splice site probably null
R2270:Mrc2 UTSW 11 105348431 splice site probably null
R2271:Mrc2 UTSW 11 105348431 splice site probably null
R2272:Mrc2 UTSW 11 105348431 splice site probably null
R2296:Mrc2 UTSW 11 105348431 splice site probably null
R2298:Mrc2 UTSW 11 105348431 splice site probably null
R2300:Mrc2 UTSW 11 105348431 splice site probably null
R2326:Mrc2 UTSW 11 105348431 splice site probably null
R2518:Mrc2 UTSW 11 105348431 splice site probably null
R2519:Mrc2 UTSW 11 105348431 splice site probably null
R2520:Mrc2 UTSW 11 105348431 splice site probably null
R2895:Mrc2 UTSW 11 105348431 splice site probably null
R3029:Mrc2 UTSW 11 105348431 splice site probably null
R3030:Mrc2 UTSW 11 105348431 splice site probably null
R3079:Mrc2 UTSW 11 105336713 missense probably damaging 0.97
R3122:Mrc2 UTSW 11 105348431 splice site probably null
R3149:Mrc2 UTSW 11 105348431 splice site probably null
R3150:Mrc2 UTSW 11 105348431 splice site probably null
R3420:Mrc2 UTSW 11 105348431 splice site probably null
R3422:Mrc2 UTSW 11 105348431 splice site probably null
R3441:Mrc2 UTSW 11 105347716 missense possibly damaging 0.87
R3726:Mrc2 UTSW 11 105348431 splice site probably null
R3731:Mrc2 UTSW 11 105348431 splice site probably null
R3800:Mrc2 UTSW 11 105348431 splice site probably null
R3820:Mrc2 UTSW 11 105348431 splice site probably null
R3821:Mrc2 UTSW 11 105348431 splice site probably null
R3837:Mrc2 UTSW 11 105348431 splice site probably null
R3838:Mrc2 UTSW 11 105348431 splice site probably null
R3849:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3850:Mrc2 UTSW 11 105292903 critical splice donor site probably null
R3914:Mrc2 UTSW 11 105347232 splice site probably benign
R3932:Mrc2 UTSW 11 105348431 splice site probably null
R3933:Mrc2 UTSW 11 105348431 splice site probably null
R3971:Mrc2 UTSW 11 105328031 missense possibly damaging 0.65
R4105:Mrc2 UTSW 11 105348431 splice site probably null
R4107:Mrc2 UTSW 11 105348431 splice site probably null
R4113:Mrc2 UTSW 11 105348431 splice site probably null
R4274:Mrc2 UTSW 11 105348431 splice site probably null
R4399:Mrc2 UTSW 11 105336658 nonsense probably null
R4477:Mrc2 UTSW 11 105348431 splice site probably null
R4478:Mrc2 UTSW 11 105348431 splice site probably null
R4493:Mrc2 UTSW 11 105348431 splice site probably null
R4494:Mrc2 UTSW 11 105348431 splice site probably null
R4495:Mrc2 UTSW 11 105348431 splice site probably null
R4547:Mrc2 UTSW 11 105336641 missense probably benign 0.04
R4600:Mrc2 UTSW 11 105348431 splice site probably null
R4601:Mrc2 UTSW 11 105348431 splice site probably null
R4602:Mrc2 UTSW 11 105348431 splice site probably null
R4603:Mrc2 UTSW 11 105348431 splice site probably null
R4610:Mrc2 UTSW 11 105348431 splice site probably null
R4611:Mrc2 UTSW 11 105348431 splice site probably null
R4637:Mrc2 UTSW 11 105348431 splice site probably null
R4672:Mrc2 UTSW 11 105343097 missense probably benign 0.22
R4674:Mrc2 UTSW 11 105348431 splice site probably null
R4675:Mrc2 UTSW 11 105348431 splice site probably null
R4693:Mrc2 UTSW 11 105343702 missense probably benign 0.00
R4706:Mrc2 UTSW 11 105348431 splice site probably null
R4707:Mrc2 UTSW 11 105348431 splice site probably null
R4791:Mrc2 UTSW 11 105348431 splice site probably null
R4792:Mrc2 UTSW 11 105348431 splice site probably null
R4888:Mrc2 UTSW 11 105341208 missense probably damaging 0.99
R5523:Mrc2 UTSW 11 105343582 missense probably benign
R5600:Mrc2 UTSW 11 105333666 missense probably damaging 1.00
R5634:Mrc2 UTSW 11 105336214 nonsense probably null
R5692:Mrc2 UTSW 11 105336642 missense probably damaging 0.99
R5706:Mrc2 UTSW 11 105332343 missense probably damaging 1.00
R5775:Mrc2 UTSW 11 105337813 missense probably benign 0.00
R6140:Mrc2 UTSW 11 105346789 missense probably benign
R6146:Mrc2 UTSW 11 105325644 missense probably damaging 0.98
R6225:Mrc2 UTSW 11 105346820 missense probably benign 0.01
R6437:Mrc2 UTSW 11 105349843 missense probably damaging 1.00
R6618:Mrc2 UTSW 11 105349882 missense probably damaging 1.00
R6675:Mrc2 UTSW 11 105343080 splice site probably null
R6680:Mrc2 UTSW 11 105325753 missense probably damaging 0.98
R6868:Mrc2 UTSW 11 105328418 missense probably damaging 1.00
R6979:Mrc2 UTSW 11 105348635 missense probably damaging 0.96
R7038:Mrc2 UTSW 11 105332236 missense possibly damaging 0.46
R7303:Mrc2 UTSW 11 105325803 missense probably damaging 1.00
R7320:Mrc2 UTSW 11 105329235 missense possibly damaging 0.92
R7537:Mrc2 UTSW 11 105292797 missense probably benign
R7709:Mrc2 UTSW 11 105346459 missense probably benign 0.10
T0970:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0004:Mrc2 UTSW 11 105347627 missense probably benign 0.41
X0062:Mrc2 UTSW 11 105347475 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGGCTGCTTGTCCTTAGTAC -3'
(R):5'- GGTACACCAGGGCTGATAATAGAC -3'

Sequencing Primer
(F):5'- GGGTCTGTATGCCTGATCCC -3'
(R):5'- ACGAAAGTTGTTGGGCTC -3'
Posted On2019-10-24