Mutagenetix > Incidental Mutations

Incidental Mutation 'R7640:Mrc2'

590204

Institutional Source

Beutler Lab

Gene Symbol

Mrc2

Ensembl Gene

ENSMUSG00000020695

Gene Name

mannose receptor, C type 2

Synonyms

Endo180, uPARAP, novel lectin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7640 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

105292643-105351139 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 105332295 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 455 (S455T)

Ref Sequence

ENSEMBL: ENSMUSP00000097909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021038] [ENSMUST00000100335]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021038
AA Change: S455T

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000021038
Gene: ENSMUSG00000020695
AA Change: S455T

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100335
AA Change: S455T

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000097909
Gene: ENSMUSG00000020695
AA Change: S455T

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
RICIN	40	160	8.49e-12	SMART
FN2	179	227	4.83e-27	SMART
CLECT	234	359	1.15e-33	SMART
CLECT	381	504	1.47e-40	SMART
CLECT	520	644	6.82e-27	SMART
CLECT	668	808	2.71e-30	SMART
CLECT	824	950	6.77e-31	SMART
CLECT	971	1107	3.91e-36	SMART
CLECT	1124	1243	1.04e-17	SMART
CLECT	1259	1392	9.08e-23	SMART
transmembrane domain	1412	1434	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mannose receptor family of proteins that contain a fibronectin type II domain and multiple C-type lectin-like domains. The encoded protein plays a role in extracellular matrix remodeling by mediating the internalization and lysosomal degradation of collagen ligands. Expression of this gene may play a role in the tumorigenesis and metastasis of several malignancies including breast cancer, gliomas and metastatic bone disease. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mice are visibly normal, viable and have no reproductive defects. Mouse embryonic fibroblasts derived from null mice exhibit decreased migration while bone marrow-derived macrophages exhibit increased migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	A	T	4: 137,454,594	N20I	probably damaging	Het
1700020D05Rik	T	A	19: 5,503,007	S249C	probably damaging	Het
4930558K02Rik	A	G	1: 161,957,149	S74P	probably benign	Het
4932415D10Rik	T	A	10: 82,294,656	N840I	probably damaging	Het
Abcb6	A	T	1: 75,174,845		probably null	Het
Adamts14	C	A	10: 61,246,057	A234S	probably benign	Het
Ankrd42	A	G	7: 92,619,635	S167P	probably benign	Het
Ap3m1	T	C	14: 21,038,175	I272V	probably benign	Het
Armt1	T	C	10: 4,453,572	F219S	probably damaging	Het
Atr	T	G	9: 95,907,293		probably null	Het
Cep72	G	A	13: 74,058,488	Q72*	probably null	Het
Clock	G	T	5: 76,248,378	L175M	possibly damaging	Het
Cnmd	T	A	14: 79,661,534	Y26F	possibly damaging	Het
Col6a6	A	T	9: 105,785,744	M198K	possibly damaging	Het
Cuta	C	T	17: 26,938,422	V135I	probably benign	Het
Ddx41	A	T	13: 55,534,239	M241K	possibly damaging	Het
Dnajc22	A	G	15: 99,101,114	N60S	probably damaging	Het
Drc3	A	G	11: 60,388,904	M432V	probably benign	Het
Eef1d	C	A	15: 75,902,707	G368C	probably damaging	Het
En2	A	T	5: 28,170,166	K236*	probably null	Het
Fas	A	G	19: 34,307,164	T24A	possibly damaging	Het
Gm13078	T	C	4: 143,726,706	V128A	probably benign	Het
Golga2	T	C	2: 32,306,239	V930A	probably benign	Het
Gprin2	G	T	14: 34,195,753	A20D	probably benign	Het
Ighv14-4	A	T	12: 114,176,444	C115*	probably null	Het
Impdh2	T	C	9: 108,565,181	Y459H	possibly damaging	Het
Klhdc7b	G	T	15: 89,387,260	V124L	possibly damaging	Het
L2hgdh	A	T	12: 69,721,357	Y122*	probably null	Het
Lamc2	A	T	1: 153,136,804	I708N	possibly damaging	Het
Large2	T	C	2: 92,374,705	M1V	probably null	Het
Lrit2	T	C	14: 37,072,124	W382R	probably damaging	Het
Mcee	T	A	7: 64,411,968	V173E	probably damaging	Het
Mcph1	T	A	8: 18,632,326	V493E	probably benign	Het
Mfap4	A	G	11: 61,487,087	N118D	probably damaging	Het
Mknk2	T	C	10: 80,668,566	S301G	probably benign	Het
Mlf1	G	A	3: 67,392,933	M94I	possibly damaging	Het
Mrgprb5	T	G	7: 48,168,259	I243L	probably benign	Het
Muc4	C	A	16: 32,760,105	P360T		Het
Nat10	G	A	2: 103,743,090	A354V	probably damaging	Het
Nts	T	C	10: 102,490,304	Q7R	possibly damaging	Het
Oas1b	T	C	5: 120,821,414	L288P	probably damaging	Het
Olfr1076	A	G	2: 86,508,943	I161M	possibly damaging	Het
Olfr1131	A	G	2: 87,629,092	I94V	probably benign	Het
Olfr1196	T	A	2: 88,700,886	I148L	probably benign	Het
Olfr633	A	T	7: 103,946,943	I126F	probably damaging	Het
Otoa	A	G	7: 121,145,626	E869G	probably damaging	Het
Pcdhac2	T	C	18: 37,144,525	L186P	probably damaging	Het
Plekhh2	A	G	17: 84,610,776	E1271G	possibly damaging	Het
Pmepa1	C	T	2: 173,276,163	A8T	probably benign	Het
Rc3h2	A	G	2: 37,377,849		probably null	Het
Rlf	T	A	4: 121,146,801	M1771L	possibly damaging	Het
Rpap1	G	A	2: 119,764,410	P1372L	possibly damaging	Het
Rragd	A	T	4: 32,983,527	D22V	probably benign	Het
Sema3f	A	T	9: 107,683,575	S644R	probably benign	Het
Sp110	G	A	1: 85,579,092	R417C		Het
Specc1l	T	A	10: 75,257,869	N717K	probably damaging	Het
Sphkap	C	T	1: 83,278,928	D367N	possibly damaging	Het
Tbc1d21	C	T	9: 58,361,261	V272M	probably damaging	Het
Tmem132c	A	G	5: 127,563,006	D747G	probably damaging	Het
Tmem56	A	G	3: 121,235,041		probably null	Het
Trim2	C	A	3: 84,190,906	V372F	probably benign	Het
Ttc34	A	G	4: 154,861,384	T292A	probably benign	Het
Ube3b	A	G	5: 114,415,323	T919A	probably benign	Het
Wdr34	T	G	2: 30,031,768	D527A	probably benign	Het
Zfhx4	T	C	3: 5,412,480	I3385T	probably benign	Het
Zfp423	T	C	8: 87,781,277	K813R	probably damaging	Het
Zfp850	T	C	7: 27,989,209	T525A	probably benign	Het
Zfp873	T	C	10: 82,060,275	I280T	possibly damaging	Het
Zkscan7	A	G	9: 122,896,056	T697A	possibly damaging	Het

Other mutations in Mrc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01105:Mrc2	APN	11	105328741	missense	probably damaging	0.96
IGL01374:Mrc2	APN	11	105347643	nonsense	probably null
IGL01751:Mrc2	APN	11	105325734	missense	probably benign	0.00
IGL01780:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL01835:Mrc2	APN	11	105336677	missense	probably damaging	1.00
IGL02350:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02357:Mrc2	APN	11	105325721	missense	probably damaging	1.00
IGL02829:Mrc2	APN	11	105336707	missense	possibly damaging	0.85
IGL02863:Mrc2	APN	11	105333620	splice site	probably benign
IGL02940:Mrc2	APN	11	105341171	missense	probably damaging	1.00
IGL02988:Mrc2	UTSW	11	105325571	missense	probably benign	0.04
R0254:Mrc2	UTSW	11	105347866	missense	probably benign	0.00
R0634:Mrc2	UTSW	11	105347692	missense	probably benign	0.01
R1102:Mrc2	UTSW	11	105340821	missense	probably benign
R1233:Mrc2	UTSW	11	105348415	missense	probably damaging	1.00
R1244:Mrc2	UTSW	11	105348431	splice site	probably null
R1458:Mrc2	UTSW	11	105337772	missense	probably benign	0.01
R1500:Mrc2	UTSW	11	105347725	missense	probably damaging	1.00
R1573:Mrc2	UTSW	11	105336656	missense	probably damaging	1.00
R1770:Mrc2	UTSW	11	105338793	missense	probably damaging	0.99
R1842:Mrc2	UTSW	11	105337720	missense	probably damaging	0.98
R2156:Mrc2	UTSW	11	105347856	splice site	probably null
R2165:Mrc2	UTSW	11	105348431	splice site	probably null
R2265:Mrc2	UTSW	11	105348431	splice site	probably null
R2266:Mrc2	UTSW	11	105348431	splice site	probably null
R2267:Mrc2	UTSW	11	105348431	splice site	probably null
R2268:Mrc2	UTSW	11	105348431	splice site	probably null
R2269:Mrc2	UTSW	11	105348431	splice site	probably null
R2270:Mrc2	UTSW	11	105348431	splice site	probably null
R2271:Mrc2	UTSW	11	105348431	splice site	probably null
R2272:Mrc2	UTSW	11	105348431	splice site	probably null
R2296:Mrc2	UTSW	11	105348431	splice site	probably null
R2298:Mrc2	UTSW	11	105348431	splice site	probably null
R2300:Mrc2	UTSW	11	105348431	splice site	probably null
R2326:Mrc2	UTSW	11	105348431	splice site	probably null
R2518:Mrc2	UTSW	11	105348431	splice site	probably null
R2519:Mrc2	UTSW	11	105348431	splice site	probably null
R2520:Mrc2	UTSW	11	105348431	splice site	probably null
R2895:Mrc2	UTSW	11	105348431	splice site	probably null
R3029:Mrc2	UTSW	11	105348431	splice site	probably null
R3030:Mrc2	UTSW	11	105348431	splice site	probably null
R3079:Mrc2	UTSW	11	105336713	missense	probably damaging	0.97
R3122:Mrc2	UTSW	11	105348431	splice site	probably null
R3149:Mrc2	UTSW	11	105348431	splice site	probably null
R3150:Mrc2	UTSW	11	105348431	splice site	probably null
R3420:Mrc2	UTSW	11	105348431	splice site	probably null
R3422:Mrc2	UTSW	11	105348431	splice site	probably null
R3441:Mrc2	UTSW	11	105347716	missense	possibly damaging	0.87
R3726:Mrc2	UTSW	11	105348431	splice site	probably null
R3731:Mrc2	UTSW	11	105348431	splice site	probably null
R3800:Mrc2	UTSW	11	105348431	splice site	probably null
R3820:Mrc2	UTSW	11	105348431	splice site	probably null
R3821:Mrc2	UTSW	11	105348431	splice site	probably null
R3837:Mrc2	UTSW	11	105348431	splice site	probably null
R3838:Mrc2	UTSW	11	105348431	splice site	probably null
R3849:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3850:Mrc2	UTSW	11	105292903	critical splice donor site	probably null
R3914:Mrc2	UTSW	11	105347232	splice site	probably benign
R3932:Mrc2	UTSW	11	105348431	splice site	probably null
R3933:Mrc2	UTSW	11	105348431	splice site	probably null
R3971:Mrc2	UTSW	11	105328031	missense	possibly damaging	0.65
R4105:Mrc2	UTSW	11	105348431	splice site	probably null
R4107:Mrc2	UTSW	11	105348431	splice site	probably null
R4113:Mrc2	UTSW	11	105348431	splice site	probably null
R4274:Mrc2	UTSW	11	105348431	splice site	probably null
R4399:Mrc2	UTSW	11	105336658	nonsense	probably null
R4477:Mrc2	UTSW	11	105348431	splice site	probably null
R4478:Mrc2	UTSW	11	105348431	splice site	probably null
R4493:Mrc2	UTSW	11	105348431	splice site	probably null
R4494:Mrc2	UTSW	11	105348431	splice site	probably null
R4495:Mrc2	UTSW	11	105348431	splice site	probably null
R4547:Mrc2	UTSW	11	105336641	missense	probably benign	0.04
R4600:Mrc2	UTSW	11	105348431	splice site	probably null
R4601:Mrc2	UTSW	11	105348431	splice site	probably null
R4602:Mrc2	UTSW	11	105348431	splice site	probably null
R4603:Mrc2	UTSW	11	105348431	splice site	probably null
R4610:Mrc2	UTSW	11	105348431	splice site	probably null
R4611:Mrc2	UTSW	11	105348431	splice site	probably null
R4637:Mrc2	UTSW	11	105348431	splice site	probably null
R4672:Mrc2	UTSW	11	105343097	missense	probably benign	0.22
R4674:Mrc2	UTSW	11	105348431	splice site	probably null
R4675:Mrc2	UTSW	11	105348431	splice site	probably null
R4693:Mrc2	UTSW	11	105343702	missense	probably benign	0.00
R4706:Mrc2	UTSW	11	105348431	splice site	probably null
R4707:Mrc2	UTSW	11	105348431	splice site	probably null
R4791:Mrc2	UTSW	11	105348431	splice site	probably null
R4792:Mrc2	UTSW	11	105348431	splice site	probably null
R4888:Mrc2	UTSW	11	105341208	missense	probably damaging	0.99
R5523:Mrc2	UTSW	11	105343582	missense	probably benign
R5600:Mrc2	UTSW	11	105333666	missense	probably damaging	1.00
R5634:Mrc2	UTSW	11	105336214	nonsense	probably null
R5692:Mrc2	UTSW	11	105336642	missense	probably damaging	0.99
R5706:Mrc2	UTSW	11	105332343	missense	probably damaging	1.00
R5775:Mrc2	UTSW	11	105337813	missense	probably benign	0.00
R6140:Mrc2	UTSW	11	105346789	missense	probably benign
R6146:Mrc2	UTSW	11	105325644	missense	probably damaging	0.98
R6225:Mrc2	UTSW	11	105346820	missense	probably benign	0.01
R6437:Mrc2	UTSW	11	105349843	missense	probably damaging	1.00
R6618:Mrc2	UTSW	11	105349882	missense	probably damaging	1.00
R6675:Mrc2	UTSW	11	105343080	splice site	probably null
R6680:Mrc2	UTSW	11	105325753	missense	probably damaging	0.98
R6868:Mrc2	UTSW	11	105328418	missense	probably damaging	1.00
R6979:Mrc2	UTSW	11	105348635	missense	probably damaging	0.96
R7038:Mrc2	UTSW	11	105332236	missense	possibly damaging	0.46
R7303:Mrc2	UTSW	11	105325803	missense	probably damaging	1.00
R7320:Mrc2	UTSW	11	105329235	missense	possibly damaging	0.92
R7422:Mrc2	UTSW	11	105292783	start gained	probably benign
R7537:Mrc2	UTSW	11	105292797	missense	probably benign
R7709:Mrc2	UTSW	11	105346459	missense	probably benign	0.10
R7885:Mrc2	UTSW	11	105332266	missense	probably damaging	0.98
R7976:Mrc2	UTSW	11	105348003	missense	possibly damaging	0.74
R8042:Mrc2	UTSW	11	105348355	missense	probably damaging	0.98
R8096:Mrc2	UTSW	11	105343507	missense	probably damaging	1.00
R8353:Mrc2	UTSW	11	105332311	missense	probably damaging	0.98
R8453:Mrc2	UTSW	11	105332311	missense	probably damaging	0.98
R8519:Mrc2	UTSW	11	105347306	missense	possibly damaging	0.62
T0970:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0004:Mrc2	UTSW	11	105347627	missense	probably benign	0.41
X0062:Mrc2	UTSW	11	105347475	critical splice donor site	probably null
Z1176:Mrc2	UTSW	11	105341376	missense	possibly damaging	0.94
Z1176:Mrc2	UTSW	11	105347360	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGCTGCTTGTCCTTAGTAC -3'
(R):5'- GGTACACCAGGGCTGATAATAGAC -3'

Sequencing Primer
(F):5'- GGGTCTGTATGCCTGATCCC -3'
(R):5'- ACGAAAGTTGTTGGGCTC -3'

Posted On

2019-10-24