Incidental Mutation 'R7640:L2hgdh'
ID 590205
Institutional Source Beutler Lab
Gene Symbol L2hgdh
Ensembl Gene ENSMUSG00000020988
Gene Name L-2-hydroxyglutarate dehydrogenase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 69690433-69724873 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 69721357 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 122 (Y122*)
Ref Sequence ENSEMBL: ENSMUSP00000021370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021370] [ENSMUST00000021372] [ENSMUST00000220460] [ENSMUST00000220539] [ENSMUST00000220916] [ENSMUST00000222950]
AlphaFold Q91YP0
Predicted Effect probably null
Transcript: ENSMUST00000021370
AA Change: Y122*
SMART Domains Protein: ENSMUSP00000021370
Gene: ENSMUSG00000020988
AA Change: Y122*

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:DAO 51 457 1.9e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021372
SMART Domains Protein: ENSMUSP00000021372
Gene: ENSMUSG00000054894

DomainStartEndE-ValueType
PDB:3E4G|A 26 200 1e-102 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000220460
Predicted Effect probably benign
Transcript: ENSMUST00000220539
Predicted Effect probably benign
Transcript: ENSMUST00000220916
Predicted Effect probably benign
Transcript: ENSMUST00000222950
Predicted Effect probably benign
Transcript: ENSMUST00000223387
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes L-2-hydroxyglutarate dehydrogenase, a FAD-dependent enzyme that oxidizes L-2-hydroxyglutarate to alpha-ketoglutarate in a variety of mammalian tissues. Mutations in this gene cause L-2-hydroxyglutaric aciduria, a rare autosomal recessive neurometabolic disorder resulting in moderate to severe mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit increased levels of lysine and arginine associated with decreases in saccharopine, glutamine, and glutamate in adult brains, neurobehavioral deficits, and brain spongiosis with vacuolar lesions mostly affecting oligodendrocytes and myelin sheaths. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Abcb6 A T 1: 75,174,845 probably null Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ankrd42 A G 7: 92,619,635 S167P probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Atr T G 9: 95,907,293 probably null Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Cnmd T A 14: 79,661,534 Y26F possibly damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
En2 A T 5: 28,170,166 K236* probably null Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mfap4 A G 11: 61,487,087 N118D probably damaging Het
Mknk2 T C 10: 80,668,566 S301G probably benign Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrc2 T A 11: 105,332,295 S455T possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Oas1b T C 5: 120,821,414 L288P probably damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1131 A G 2: 87,629,092 I94V probably benign Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Pmepa1 C T 2: 173,276,163 A8T probably benign Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rpap1 G A 2: 119,764,410 P1372L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sema3f A T 9: 107,683,575 S644R probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Specc1l T A 10: 75,257,869 N717K probably damaging Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zfp873 T C 10: 82,060,275 I280T possibly damaging Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in L2hgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:L2hgdh APN 12 69701434 missense possibly damaging 0.67
IGL01505:L2hgdh APN 12 69721401 missense probably damaging 1.00
IGL01871:L2hgdh APN 12 69722095 missense probably damaging 1.00
IGL02169:L2hgdh APN 12 69721397 missense probably damaging 1.00
IGL02253:L2hgdh APN 12 69705760 splice site probably benign
IGL02670:L2hgdh APN 12 69692480 missense possibly damaging 0.86
IGL03069:L2hgdh APN 12 69692399 missense probably benign
R0054:L2hgdh UTSW 12 69721331 missense possibly damaging 0.82
R0106:L2hgdh UTSW 12 69705789 nonsense probably null
R0106:L2hgdh UTSW 12 69705789 nonsense probably null
R0579:L2hgdh UTSW 12 69701272 splice site probably benign
R1421:L2hgdh UTSW 12 69701318 missense probably benign
R1797:L2hgdh UTSW 12 69699566 missense probably benign
R3082:L2hgdh UTSW 12 69722084 missense probably benign 0.00
R9087:L2hgdh UTSW 12 69702357 missense probably benign
R9582:L2hgdh UTSW 12 69692398 missense probably benign 0.02
Z1176:L2hgdh UTSW 12 69707132 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAATGGTTGTAAGGGGTCCG -3'
(R):5'- TCCTAGGCTTTGTGTGAGACATTTAC -3'

Sequencing Primer
(F):5'- CTGGTACAACTTTGTAAATATGCAAC -3'
(R):5'- AACAGCGGTGTCATACAC -3'
Posted On 2019-10-24