Incidental Mutation 'R7640:Ddx41'
ID 590207
Institutional Source Beutler Lab
Gene Symbol Ddx41
Ensembl Gene ENSMUSG00000021494
Gene Name DEAD box helicase 41
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 41, 2900024F02Rik
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 55678223-55684471 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55682052 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 241 (M241K)
Ref Sequence ENSEMBL: ENSMUSP00000021956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021956] [ENSMUST00000223563] [ENSMUST00000224765]
AlphaFold Q91VN6
Predicted Effect possibly damaging
Transcript: ENSMUST00000021956
AA Change: M241K

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021956
Gene: ENSMUSG00000021494
AA Change: M241K

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 39 56 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
DEXDc 200 411 8.56e-53 SMART
HELICc 446 527 5.99e-34 SMART
ZnF_C2HC 581 597 1.98e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223563
Predicted Effect possibly damaging
Transcript: ENSMUST00000224765
AA Change: M252K

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD box protein family and interacts with several spliceosomal proteins. In addition, the encoded protein may recognize the bacterial second messengers cyclic di-GMP and cyclic di-AMP, resulting in the induction of genes involved in the innate immune response. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Atr T G 9: 95,789,346 (GRCm39) probably null Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Clock G T 5: 76,396,225 (GRCm39) L175M possibly damaging Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Cuta C T 17: 27,157,396 (GRCm39) V135I probably benign Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Fas A G 19: 34,284,564 (GRCm39) T24A possibly damaging Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Lamc2 A T 1: 153,012,550 (GRCm39) I708N possibly damaging Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Muc4 C A 16: 32,580,479 (GRCm39) P360T Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or5w11 A G 2: 87,459,436 (GRCm39) I94V probably benign Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pmepa1 C T 2: 173,117,956 (GRCm39) A8T probably benign Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rpap1 G A 2: 119,594,891 (GRCm39) P1372L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sema3f A T 9: 107,560,774 (GRCm39) S644R probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tlcd4 A G 3: 121,028,690 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,070 (GRCm39) D747G probably damaging Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp423 T C 8: 88,507,905 (GRCm39) K813R probably damaging Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Ddx41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ddx41 APN 13 55,679,212 (GRCm39) missense probably damaging 1.00
IGL00516:Ddx41 APN 13 55,680,280 (GRCm39) missense probably damaging 0.96
IGL02383:Ddx41 APN 13 55,680,170 (GRCm39) missense probably benign 0.04
R0081:Ddx41 UTSW 13 55,683,193 (GRCm39) missense possibly damaging 0.58
R0097:Ddx41 UTSW 13 55,683,691 (GRCm39) splice site probably benign
R0412:Ddx41 UTSW 13 55,678,421 (GRCm39) missense probably damaging 0.99
R0597:Ddx41 UTSW 13 55,680,819 (GRCm39) missense probably damaging 1.00
R0699:Ddx41 UTSW 13 55,679,112 (GRCm39) splice site probably benign
R1330:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R1812:Ddx41 UTSW 13 55,683,767 (GRCm39) missense probably benign 0.03
R2011:Ddx41 UTSW 13 55,681,906 (GRCm39) splice site probably null
R2224:Ddx41 UTSW 13 55,679,214 (GRCm39) missense probably damaging 1.00
R2310:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R2311:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R2355:Ddx41 UTSW 13 55,682,113 (GRCm39) missense probably benign 0.03
R2983:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R3032:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R3764:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R3773:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R3916:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R3926:Ddx41 UTSW 13 55,679,083 (GRCm39) missense probably damaging 1.00
R4153:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R4154:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R4372:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R4470:Ddx41 UTSW 13 55,682,293 (GRCm39) missense possibly damaging 0.87
R4519:Ddx41 UTSW 13 55,680,957 (GRCm39) missense probably damaging 1.00
R4569:Ddx41 UTSW 13 55,683,834 (GRCm39) missense possibly damaging 0.88
R4823:Ddx41 UTSW 13 55,679,868 (GRCm39) missense probably benign 0.02
R4837:Ddx41 UTSW 13 55,679,461 (GRCm39) missense possibly damaging 0.95
R5443:Ddx41 UTSW 13 55,683,104 (GRCm39) missense probably benign 0.00
R5642:Ddx41 UTSW 13 55,683,708 (GRCm39) missense possibly damaging 0.86
R5926:Ddx41 UTSW 13 55,682,112 (GRCm39) missense probably damaging 0.99
R5949:Ddx41 UTSW 13 55,679,874 (GRCm39) missense probably damaging 1.00
R6035:Ddx41 UTSW 13 55,681,781 (GRCm39) missense probably benign 0.00
R6035:Ddx41 UTSW 13 55,681,781 (GRCm39) missense probably benign 0.00
R7254:Ddx41 UTSW 13 55,681,769 (GRCm39) nonsense probably null
R7803:Ddx41 UTSW 13 55,679,734 (GRCm39) missense probably damaging 1.00
R8690:Ddx41 UTSW 13 55,680,939 (GRCm39) missense probably damaging 1.00
R8714:Ddx41 UTSW 13 55,682,250 (GRCm39) missense probably damaging 1.00
R9071:Ddx41 UTSW 13 55,680,219 (GRCm39) missense probably damaging 0.96
R9089:Ddx41 UTSW 13 55,683,424 (GRCm39) missense probably benign 0.05
R9312:Ddx41 UTSW 13 55,683,842 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGCAGTAATACTCCAGGATGC -3'
(R):5'- ATTCAGATCCAGGGCATCCC -3'

Sequencing Primer
(F):5'- TAATACTCCAGGATGCCGTGG -3'
(R):5'- CATCCCTACCATGTAAGTGTGGG -3'
Posted On 2019-10-24