Incidental Mutation 'R7640:Cnmd'
ID 590212
Institutional Source Beutler Lab
Gene Symbol Cnmd
Ensembl Gene ENSMUSG00000022025
Gene Name chondromodulin
Synonyms Chondromodulin 1, Bricd3, ChM-I
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 79637690-79662170 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79661534 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 26 (Y26F)
Ref Sequence ENSEMBL: ENSMUSP00000126958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022603] [ENSMUST00000165835]
AlphaFold Q9Z1F6
Predicted Effect possibly damaging
Transcript: ENSMUST00000022603
AA Change: Y26F

PolyPhen 2 Score 0.618 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022603
Gene: ENSMUSG00000022025
AA Change: Y26F

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
BRICHOS 105 201 1.24e-33 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165835
AA Change: Y26F

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126958
Gene: ENSMUSG00000022025
AA Change: Y26F

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
BRICHOS 105 201 1.24e-33 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated transmembrane protein that is cleaved to form a mature, secreted protein. The N-terminus of the precursor protein shares characteristics with other surfactant proteins and is sometimes called chondrosurfactant protein although no biological activity has yet been defined for it. The C-terminus of the precursor protein contains a 25 kDa mature protein called leukocyte cell-derived chemotaxin-1 or chondromodulin-1. The mature protein promotes chondrocyte growth and inhibits angiogenesis. This gene is expressed in the avascular zone of prehypertrophic cartilage and its expression decreases during chondrocyte hypertrophy and vascular invasion. The mature protein likely plays a role in endochondral bone development by permitting cartilaginous anlagen to be vascularized and replaced by bone. It may be involved also in the broad control of tissue vascularization during development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and show no gross morphologic defects. While cartilage development and embryonic endochondral bone formation were found to be normal in mutant mice, one line of targeted mutants showed increased bone density and impairedbone resorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,454,594 N20I probably damaging Het
1700020D05Rik T A 19: 5,503,007 S249C probably damaging Het
4930558K02Rik A G 1: 161,957,149 S74P probably benign Het
4932415D10Rik T A 10: 82,294,656 N840I probably damaging Het
Abcb6 A T 1: 75,174,845 probably null Het
Adamts14 C A 10: 61,246,057 A234S probably benign Het
Ankrd42 A G 7: 92,619,635 S167P probably benign Het
Ap3m1 T C 14: 21,038,175 I272V probably benign Het
Armt1 T C 10: 4,453,572 F219S probably damaging Het
Atr T G 9: 95,907,293 probably null Het
Cep72 G A 13: 74,058,488 Q72* probably null Het
Clock G T 5: 76,248,378 L175M possibly damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Cuta C T 17: 26,938,422 V135I probably benign Het
Ddx41 A T 13: 55,534,239 M241K possibly damaging Het
Dnajc22 A G 15: 99,101,114 N60S probably damaging Het
Drc3 A G 11: 60,388,904 M432V probably benign Het
Eef1d C A 15: 75,902,707 G368C probably damaging Het
En2 A T 5: 28,170,166 K236* probably null Het
Fas A G 19: 34,307,164 T24A possibly damaging Het
Gm13078 T C 4: 143,726,706 V128A probably benign Het
Golga2 T C 2: 32,306,239 V930A probably benign Het
Gprin2 G T 14: 34,195,753 A20D probably benign Het
Ighv14-4 A T 12: 114,176,444 C115* probably null Het
Impdh2 T C 9: 108,565,181 Y459H possibly damaging Het
Klhdc7b G T 15: 89,387,260 V124L possibly damaging Het
L2hgdh A T 12: 69,721,357 Y122* probably null Het
Lamc2 A T 1: 153,136,804 I708N possibly damaging Het
Large2 T C 2: 92,374,705 M1V probably null Het
Lrit2 T C 14: 37,072,124 W382R probably damaging Het
Mcee T A 7: 64,411,968 V173E probably damaging Het
Mcph1 T A 8: 18,632,326 V493E probably benign Het
Mfap4 A G 11: 61,487,087 N118D probably damaging Het
Mknk2 T C 10: 80,668,566 S301G probably benign Het
Mlf1 G A 3: 67,392,933 M94I possibly damaging Het
Mrc2 T A 11: 105,332,295 S455T possibly damaging Het
Mrgprb5 T G 7: 48,168,259 I243L probably benign Het
Muc4 C A 16: 32,760,105 P360T Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Nts T C 10: 102,490,304 Q7R possibly damaging Het
Oas1b T C 5: 120,821,414 L288P probably damaging Het
Olfr1076 A G 2: 86,508,943 I161M possibly damaging Het
Olfr1131 A G 2: 87,629,092 I94V probably benign Het
Olfr1196 T A 2: 88,700,886 I148L probably benign Het
Olfr633 A T 7: 103,946,943 I126F probably damaging Het
Otoa A G 7: 121,145,626 E869G probably damaging Het
Pcdhac2 T C 18: 37,144,525 L186P probably damaging Het
Plekhh2 A G 17: 84,610,776 E1271G possibly damaging Het
Pmepa1 C T 2: 173,276,163 A8T probably benign Het
Rc3h2 A G 2: 37,377,849 probably null Het
Rlf T A 4: 121,146,801 M1771L possibly damaging Het
Rpap1 G A 2: 119,764,410 P1372L possibly damaging Het
Rragd A T 4: 32,983,527 D22V probably benign Het
Sema3f A T 9: 107,683,575 S644R probably benign Het
Sp110 G A 1: 85,579,092 R417C probably benign Het
Specc1l T A 10: 75,257,869 N717K probably damaging Het
Sphkap C T 1: 83,278,928 D367N possibly damaging Het
Tbc1d21 C T 9: 58,361,261 V272M probably damaging Het
Tmem132c A G 5: 127,563,006 D747G probably damaging Het
Tmem56 A G 3: 121,235,041 probably null Het
Trim2 C A 3: 84,190,906 V372F probably benign Het
Ttc34 A G 4: 154,861,384 T292A probably benign Het
Ube3b A G 5: 114,415,323 T919A probably benign Het
Wdr34 T G 2: 30,031,768 D527A probably benign Het
Zfhx4 T C 3: 5,412,480 I3385T probably benign Het
Zfp423 T C 8: 87,781,277 K813R probably damaging Het
Zfp850 T C 7: 27,989,209 T525A probably benign Het
Zfp873 T C 10: 82,060,275 I280T possibly damaging Het
Zkscan7 A G 9: 122,896,056 T697A possibly damaging Het
Other mutations in Cnmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cnmd APN 14 79642068 splice site probably benign
IGL02556:Cnmd APN 14 79661960 missense probably benign 0.00
IGL03034:Cnmd APN 14 79641928 missense probably benign
R0529:Cnmd UTSW 14 79642041 missense probably benign 0.00
R0811:Cnmd UTSW 14 79661423 missense probably damaging 1.00
R0812:Cnmd UTSW 14 79661423 missense probably damaging 1.00
R0844:Cnmd UTSW 14 79641951 missense probably benign 0.37
R2401:Cnmd UTSW 14 79656605 missense probably damaging 0.98
R2419:Cnmd UTSW 14 79638048 missense probably damaging 1.00
R3697:Cnmd UTSW 14 79637981 missense probably damaging 1.00
R4640:Cnmd UTSW 14 79656653 missense probably damaging 1.00
R4841:Cnmd UTSW 14 79650322 missense possibly damaging 0.94
R4845:Cnmd UTSW 14 79662008 missense probably benign
R5157:Cnmd UTSW 14 79656686 missense probably benign 0.39
R5959:Cnmd UTSW 14 79656669 missense probably damaging 1.00
R6033:Cnmd UTSW 14 79661505 missense probably benign 0.00
R6033:Cnmd UTSW 14 79661505 missense probably benign 0.00
R7421:Cnmd UTSW 14 79645507 missense probably benign 0.25
R8007:Cnmd UTSW 14 79637966 missense probably damaging 1.00
R8350:Cnmd UTSW 14 79645381 nonsense probably null
R8450:Cnmd UTSW 14 79645381 nonsense probably null
R9009:Cnmd UTSW 14 79656645 missense probably damaging 1.00
R9745:Cnmd UTSW 14 79650410 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AACTGGGGAGTCACTCGTTG -3'
(R):5'- GTACAGAGGATCCACCACAG -3'

Sequencing Primer
(F):5'- GGAGTCACTCGTTGAACTTACG -3'
(R):5'- CCTAGGGAAGAGTCTGCTATGGTAC -3'
Posted On 2019-10-24