Incidental Mutation 'R7640:Muc4'
ID 590216
Institutional Source Beutler Lab
Gene Symbol Muc4
Ensembl Gene ENSMUSG00000079620
Gene Name mucin 4
Synonyms 4933405I11Rik
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 32555089-32602761 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 32580479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 360 (P360T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096106]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000096106
AA Change: P2430T
SMART Domains Protein: ENSMUSP00000093813
Gene: ENSMUSG00000079620
AA Change: P2430T

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 37 65 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
internal_repeat_2 119 903 6.07e-127 PROSPERO
internal_repeat_1 164 987 3.47e-144 PROSPERO
internal_repeat_2 979 1875 6.07e-127 PROSPERO
internal_repeat_1 1193 2087 3.47e-144 PROSPERO
low complexity region 2090 2106 N/A INTRINSIC
low complexity region 2111 2119 N/A INTRINSIC
low complexity region 2186 2195 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2324 2332 N/A INTRINSIC
low complexity region 2344 2367 N/A INTRINSIC
NIDO 2458 2615 8.33e-67 SMART
AMOP 2614 2726 1.29e-47 SMART
VWD 2729 2910 4.23e-26 SMART
EGF_like 3134 3166 3.23e1 SMART
EGF_like 3176 3212 3.5e1 SMART
low complexity region 3237 3251 N/A INTRINSIC
EGF 3384 3421 1.4e0 SMART
transmembrane domain 3430 3452 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119154
Gene: ENSMUSG00000079620
AA Change: P360T

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 117 126 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
low complexity region 255 263 N/A INTRINSIC
low complexity region 275 298 N/A INTRINSIC
NIDO 389 546 8.33e-67 SMART
AMOP 545 657 1.29e-47 SMART
VWD 660 841 4.23e-26 SMART
EGF_like 1065 1097 3.23e1 SMART
EGF_like 1107 1143 3.5e1 SMART
low complexity region 1168 1182 N/A INTRINSIC
EGF 1315 1352 1.4e0 SMART
transmembrane domain 1361 1383 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface. A large 5' exon encodes at least 15 tandem repeats of 124-126 amino acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to DSS-treated colitis and colitis-associated colorectal cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Atr T G 9: 95,789,346 (GRCm39) probably null Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Clock G T 5: 76,396,225 (GRCm39) L175M possibly damaging Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Cuta C T 17: 27,157,396 (GRCm39) V135I probably benign Het
Ddx41 A T 13: 55,682,052 (GRCm39) M241K possibly damaging Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Fas A G 19: 34,284,564 (GRCm39) T24A possibly damaging Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Lamc2 A T 1: 153,012,550 (GRCm39) I708N possibly damaging Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or5w11 A G 2: 87,459,436 (GRCm39) I94V probably benign Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pmepa1 C T 2: 173,117,956 (GRCm39) A8T probably benign Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rpap1 G A 2: 119,594,891 (GRCm39) P1372L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sema3f A T 9: 107,560,774 (GRCm39) S644R probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tlcd4 A G 3: 121,028,690 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,070 (GRCm39) D747G probably damaging Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp423 T C 8: 88,507,905 (GRCm39) K813R probably damaging Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Muc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00088:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00089:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00090:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00091:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00092:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL00163:Muc4 APN 16 32,754,090 (GRCm38) missense probably benign 0.20
IGL00324:Muc4 APN 16 32,599,186 (GRCm39) missense probably benign 0.03
IGL00331:Muc4 APN 16 32,574,613 (GRCm39) missense probably benign 0.01
IGL00539:Muc4 APN 16 32,569,728 (GRCm39) missense possibly damaging 0.53
IGL00590:Muc4 APN 16 32,575,465 (GRCm39) missense probably benign 0.10
IGL00990:Muc4 APN 16 32,753,886 (GRCm38) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,753,863 (GRCm38) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,752,569 (GRCm38) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,575,140 (GRCm39) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,575,139 (GRCm39) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,575,114 (GRCm39) missense probably benign 0.01
IGL00990:Muc4 APN 16 32,576,179 (GRCm39) unclassified probably benign
IGL00990:Muc4 APN 16 32,575,246 (GRCm39) missense possibly damaging 0.86
IGL00990:Muc4 APN 16 32,575,362 (GRCm39) missense probably benign 0.01
IGL01091:Muc4 APN 16 32,753,927 (GRCm38) missense probably benign 0.04
IGL01124:Muc4 APN 16 32,589,104 (GRCm39) missense possibly damaging 0.65
IGL01131:Muc4 APN 16 32,753,901 (GRCm38) missense possibly damaging 0.72
IGL01536:Muc4 APN 16 32,584,340 (GRCm39) missense possibly damaging 0.93
IGL01603:Muc4 APN 16 32,569,473 (GRCm39) missense probably benign 0.23
IGL01618:Muc4 APN 16 32,577,001 (GRCm39) missense unknown
IGL01625:Muc4 APN 16 32,575,918 (GRCm39) unclassified probably benign
IGL01626:Muc4 APN 16 32,555,220 (GRCm39) missense possibly damaging 0.48
IGL01653:Muc4 APN 16 32,581,722 (GRCm39) splice site probably null
IGL01682:Muc4 APN 16 32,754,086 (GRCm38) missense probably benign 0.35
IGL01870:Muc4 APN 16 32,574,624 (GRCm39) missense probably benign 0.01
IGL01966:Muc4 APN 16 32,570,244 (GRCm39) missense possibly damaging 0.84
IGL01973:Muc4 APN 16 32,575,383 (GRCm39) missense probably benign 0.01
IGL02089:Muc4 APN 16 32,570,131 (GRCm39) missense possibly damaging 0.83
IGL02152:Muc4 APN 16 32,598,023 (GRCm39) splice site probably benign
IGL02210:Muc4 APN 16 32,574,054 (GRCm39) missense probably benign 0.00
IGL02278:Muc4 APN 16 32,754,529 (GRCm38) missense probably benign 0.01
IGL02280:Muc4 APN 16 32,754,529 (GRCm38) missense probably benign 0.01
IGL02316:Muc4 APN 16 32,569,668 (GRCm39) missense possibly damaging 0.73
IGL02351:Muc4 APN 16 32,569,804 (GRCm39) missense possibly damaging 0.86
IGL02358:Muc4 APN 16 32,569,804 (GRCm39) missense possibly damaging 0.86
IGL02391:Muc4 APN 16 32,570,894 (GRCm39) missense probably benign 0.41
IGL02449:Muc4 APN 16 32,576,503 (GRCm39) unclassified probably benign
IGL02607:Muc4 APN 16 32,596,193 (GRCm39) missense possibly damaging 0.73
IGL02888:Muc4 APN 16 32,575,656 (GRCm39) unclassified probably benign
IGL02893:Muc4 APN 16 32,570,466 (GRCm39) missense possibly damaging 0.68
IGL02902:Muc4 APN 16 32,569,212 (GRCm39) missense possibly damaging 0.50
IGL03007:Muc4 APN 16 32,570,866 (GRCm39) missense possibly damaging 0.84
IGL03161:Muc4 APN 16 32,570,766 (GRCm39) missense possibly damaging 0.84
IGL03304:Muc4 APN 16 32,570,257 (GRCm39) nonsense probably null
IGL03335:Muc4 APN 16 32,574,449 (GRCm39) missense probably benign 0.01
IGL03411:Muc4 APN 16 32,575,436 (GRCm39) missense probably benign 0.01
multisplendored UTSW 16 32,569,869 (GRCm39) missense possibly damaging 0.53
protean UTSW 16 32,754,689 (GRCm38) missense probably benign 0.00
R0864_muc4_269 UTSW 16 32,570,820 (GRCm39) missense probably benign 0.01
3-1:Muc4 UTSW 16 32,590,768 (GRCm39) missense possibly damaging 0.86
3-1:Muc4 UTSW 16 32,580,625 (GRCm39) splice site probably benign
BB004:Muc4 UTSW 16 32,592,011 (GRCm39) missense
BB014:Muc4 UTSW 16 32,592,011 (GRCm39) missense
IGL02835:Muc4 UTSW 16 32,584,319 (GRCm39) missense probably benign 0.32
P0035:Muc4 UTSW 16 32,580,622 (GRCm39) splice site probably benign
PIT4131001:Muc4 UTSW 16 32,755,684 (GRCm38) unclassified probably benign
PIT4131001:Muc4 UTSW 16 32,755,699 (GRCm38) unclassified probably benign
PIT4131001:Muc4 UTSW 16 32,755,676 (GRCm38) unclassified probably benign
PIT4142001:Muc4 UTSW 16 32,755,684 (GRCm38) unclassified probably benign
PIT4142001:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
PIT4142001:Muc4 UTSW 16 32,755,676 (GRCm38) unclassified probably benign
PIT4366001:Muc4 UTSW 16 32,575,542 (GRCm39) missense unknown
PIT4531001:Muc4 UTSW 16 32,576,391 (GRCm39) missense unknown
R0119:Muc4 UTSW 16 32,569,013 (GRCm39) critical splice acceptor site probably benign
R0133:Muc4 UTSW 16 32,591,978 (GRCm39) missense possibly damaging 0.91
R0136:Muc4 UTSW 16 32,569,013 (GRCm39) critical splice acceptor site probably benign
R0243:Muc4 UTSW 16 32,586,120 (GRCm39) missense possibly damaging 0.53
R0277:Muc4 UTSW 16 32,755,690 (GRCm38) unclassified probably benign
R0299:Muc4 UTSW 16 32,569,013 (GRCm39) critical splice acceptor site probably benign
R0380:Muc4 UTSW 16 32,574,333 (GRCm39) missense probably benign 0.00
R0462:Muc4 UTSW 16 32,582,910 (GRCm39) missense possibly damaging 0.93
R0507:Muc4 UTSW 16 32,569,887 (GRCm39) missense probably benign 0.01
R0508:Muc4 UTSW 16 32,570,131 (GRCm39) missense possibly damaging 0.83
R0543:Muc4 UTSW 16 32,577,120 (GRCm39) missense unknown
R0578:Muc4 UTSW 16 32,755,690 (GRCm38) unclassified probably benign
R0617:Muc4 UTSW 16 32,570,925 (GRCm39) missense possibly damaging 0.83
R0656:Muc4 UTSW 16 32,570,488 (GRCm39) missense possibly damaging 0.91
R0726:Muc4 UTSW 16 32,590,201 (GRCm39) missense probably damaging 0.99
R0727:Muc4 UTSW 16 32,590,221 (GRCm39) missense probably benign 0.01
R0776:Muc4 UTSW 16 32,574,020 (GRCm39) missense probably benign 0.04
R0854:Muc4 UTSW 16 32,599,329 (GRCm39) missense possibly damaging 0.53
R0862:Muc4 UTSW 16 32,570,820 (GRCm39) missense probably benign 0.01
R0864:Muc4 UTSW 16 32,570,820 (GRCm39) missense probably benign 0.01
R0926:Muc4 UTSW 16 32,576,570 (GRCm39) unclassified probably benign
R0990:Muc4 UTSW 16 32,752,722 (GRCm38) missense probably benign 0.00
R1127:Muc4 UTSW 16 32,569,343 (GRCm39) missense possibly damaging 0.92
R1203:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R1433:Muc4 UTSW 16 32,574,448 (GRCm39) missense probably benign 0.00
R1466:Muc4 UTSW 16 32,574,886 (GRCm39) missense probably benign 0.04
R1466:Muc4 UTSW 16 32,574,886 (GRCm39) missense probably benign 0.04
R1506:Muc4 UTSW 16 32,574,033 (GRCm39) missense possibly damaging 0.59
R1518:Muc4 UTSW 16 32,569,167 (GRCm39) missense possibly damaging 0.84
R1544:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R1584:Muc4 UTSW 16 32,574,886 (GRCm39) missense probably benign 0.04
R1593:Muc4 UTSW 16 32,754,686 (GRCm38) missense probably benign 0.00
R1601:Muc4 UTSW 16 32,575,875 (GRCm39) unclassified probably benign
R1611:Muc4 UTSW 16 32,569,804 (GRCm39) missense possibly damaging 0.86
R1673:Muc4 UTSW 16 32,577,276 (GRCm39) missense probably benign 0.11
R1717:Muc4 UTSW 16 32,753,405 (GRCm38) missense possibly damaging 0.53
R1822:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R1824:Muc4 UTSW 16 32,576,307 (GRCm39) unclassified probably benign
R1839:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R1846:Muc4 UTSW 16 32,752,369 (GRCm38) missense probably benign 0.01
R1864:Muc4 UTSW 16 32,576,625 (GRCm39) unclassified probably benign
R1868:Muc4 UTSW 16 32,576,715 (GRCm39) missense unknown
R1928:Muc4 UTSW 16 32,569,350 (GRCm39) missense probably damaging 0.99
R1942:Muc4 UTSW 16 32,569,460 (GRCm39) missense probably damaging 0.99
R2017:Muc4 UTSW 16 32,570,121 (GRCm39) missense possibly damaging 0.92
R2023:Muc4 UTSW 16 32,574,054 (GRCm39) missense probably benign 0.00
R2081:Muc4 UTSW 16 32,574,020 (GRCm39) missense probably benign 0.04
R2088:Muc4 UTSW 16 32,576,783 (GRCm39) missense unknown
R2121:Muc4 UTSW 16 32,580,612 (GRCm39) missense unknown
R2139:Muc4 UTSW 16 32,581,599 (GRCm39) missense unknown
R2158:Muc4 UTSW 16 32,754,563 (GRCm38) missense probably benign 0.10
R2165:Muc4 UTSW 16 32,569,294 (GRCm39) missense probably damaging 0.96
R2210:Muc4 UTSW 16 32,755,176 (GRCm38) frame shift probably null
R2225:Muc4 UTSW 16 32,587,316 (GRCm39) missense possibly damaging 0.73
R2225:Muc4 UTSW 16 32,576,265 (GRCm39) unclassified probably benign
R2269:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R2679:Muc4 UTSW 16 32,577,846 (GRCm39) missense unknown
R3703:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R3816:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R3909:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R4014:Muc4 UTSW 16 32,575,647 (GRCm39) unclassified probably benign
R4065:Muc4 UTSW 16 32,569,869 (GRCm39) missense possibly damaging 0.53
R4066:Muc4 UTSW 16 32,569,869 (GRCm39) missense possibly damaging 0.53
R4067:Muc4 UTSW 16 32,569,869 (GRCm39) missense possibly damaging 0.53
R4245:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4249:Muc4 UTSW 16 32,576,200 (GRCm39) unclassified probably benign
R4344:Muc4 UTSW 16 32,590,666 (GRCm39) missense possibly damaging 0.53
R4388:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4393:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R4482:Muc4 UTSW 16 32,577,075 (GRCm39) missense unknown
R4523:Muc4 UTSW 16 32,555,154 (GRCm39) utr 5 prime probably benign
R4527:Muc4 UTSW 16 32,576,217 (GRCm39) unclassified probably benign
R4572:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4587:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R4614:Muc4 UTSW 16 32,577,432 (GRCm39) missense probably benign 0.03
R4635:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4661:Muc4 UTSW 16 32,589,651 (GRCm39) missense possibly damaging 0.71
R4701:Muc4 UTSW 16 32,576,220 (GRCm39) unclassified probably benign
R4730:Muc4 UTSW 16 32,570,032 (GRCm39) missense possibly damaging 0.86
R4740:Muc4 UTSW 16 32,596,277 (GRCm39) missense possibly damaging 0.91
R4762:Muc4 UTSW 16 32,574,916 (GRCm39) unclassified probably benign
R4818:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R4821:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R4825:Muc4 UTSW 16 32,570,565 (GRCm39) missense probably benign 0.41
R4830:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R4860:Muc4 UTSW 16 32,754,625 (GRCm38) missense probably benign 0.18
R4860:Muc4 UTSW 16 32,754,616 (GRCm38) missense probably benign 0.35
R4869:Muc4 UTSW 16 32,754,836 (GRCm38) unclassified probably benign
R4934:Muc4 UTSW 16 32,576,472 (GRCm39) unclassified probably benign
R4959:Muc4 UTSW 16 32,575,437 (GRCm39) missense possibly damaging 0.73
R4969:Muc4 UTSW 16 32,754,572 (GRCm38) missense probably benign 0.01
R4995:Muc4 UTSW 16 32,575,332 (GRCm39) missense probably benign 0.01
R4995:Muc4 UTSW 16 32,754,214 (GRCm38) missense probably benign 0.01
R4999:Muc4 UTSW 16 32,576,670 (GRCm39) unclassified probably benign
R5073:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R5075:Muc4 UTSW 16 32,754,794 (GRCm38) unclassified probably benign
R5152:Muc4 UTSW 16 32,577,432 (GRCm39) nonsense probably null
R5161:Muc4 UTSW 16 32,582,895 (GRCm39) missense probably damaging 0.98
R5174:Muc4 UTSW 16 32,570,556 (GRCm39) missense possibly damaging 0.84
R5268:Muc4 UTSW 16 32,570,484 (GRCm39) missense possibly damaging 0.83
R5447:Muc4 UTSW 16 32,753,919 (GRCm38) missense probably benign 0.10
R5474:Muc4 UTSW 16 32,581,635 (GRCm39) missense unknown
R5567:Muc4 UTSW 16 32,598,066 (GRCm39) missense possibly damaging 0.72
R5570:Muc4 UTSW 16 32,598,066 (GRCm39) missense possibly damaging 0.72
R5618:Muc4 UTSW 16 32,754,253 (GRCm38) missense probably benign 0.01
R5665:Muc4 UTSW 16 32,569,600 (GRCm39) missense probably benign 0.33
R5667:Muc4 UTSW 16 32,575,011 (GRCm39) missense probably benign 0.01
R5671:Muc4 UTSW 16 32,575,011 (GRCm39) missense probably benign 0.01
R5693:Muc4 UTSW 16 32,597,181 (GRCm39) missense possibly damaging 0.53
R5703:Muc4 UTSW 16 32,555,059 (GRCm39) nonsense probably null
R5708:Muc4 UTSW 16 32,575,515 (GRCm39) unclassified probably benign
R5715:Muc4 UTSW 16 32,570,734 (GRCm39) missense possibly damaging 0.92
R5849:Muc4 UTSW 16 32,595,213 (GRCm39) missense possibly damaging 0.53
R5873:Muc4 UTSW 16 32,570,113 (GRCm39) missense possibly damaging 0.61
R5930:Muc4 UTSW 16 32,570,523 (GRCm39) missense probably benign 0.41
R5933:Muc4 UTSW 16 32,574,480 (GRCm39) missense probably benign 0.01
R5966:Muc4 UTSW 16 32,576,652 (GRCm39) unclassified probably benign
R6062:Muc4 UTSW 16 32,579,682 (GRCm39) missense unknown
R6067:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
R6067:Muc4 UTSW 16 32,575,621 (GRCm39) unclassified probably benign
R6078:Muc4 UTSW 16 32,575,621 (GRCm39) unclassified probably benign
R6079:Muc4 UTSW 16 32,575,621 (GRCm39) unclassified probably benign
R6112:Muc4 UTSW 16 32,596,157 (GRCm39) missense possibly damaging 0.86
R6120:Muc4 UTSW 16 32,577,169 (GRCm39) missense unknown
R6144:Muc4 UTSW 16 32,587,298 (GRCm39) missense possibly damaging 0.53
R6148:Muc4 UTSW 16 32,753,802 (GRCm38) missense probably benign 0.04
R6173:Muc4 UTSW 16 32,554,958 (GRCm39) start gained probably benign
R6268:Muc4 UTSW 16 32,589,141 (GRCm39) missense probably damaging 0.99
R6299:Muc4 UTSW 16 32,570,853 (GRCm39) missense possibly damaging 0.48
R6307:Muc4 UTSW 16 32,575,237 (GRCm39) missense possibly damaging 0.56
R6354:Muc4 UTSW 16 32,575,476 (GRCm39) missense probably benign 0.19
R6361:Muc4 UTSW 16 32,587,725 (GRCm39) missense probably benign 0.32
R6375:Muc4 UTSW 16 32,555,061 (GRCm39) utr 5 prime probably benign
R6378:Muc4 UTSW 16 32,599,320 (GRCm39) missense probably benign 0.33
R6418:Muc4 UTSW 16 32,570,607 (GRCm39) missense possibly damaging 0.68
R6458:Muc4 UTSW 16 32,579,694 (GRCm39) critical splice donor site probably null
R6527:Muc4 UTSW 16 32,753,433 (GRCm38) missense probably benign 0.01
R6616:Muc4 UTSW 16 32,602,378 (GRCm39) missense possibly damaging 0.93
R6636:Muc4 UTSW 16 32,575,255 (GRCm39) missense probably benign 0.01
R6637:Muc4 UTSW 16 32,575,255 (GRCm39) missense probably benign 0.01
R6915:Muc4 UTSW 16 32,587,312 (GRCm39) missense probably benign 0.18
R6947:Muc4 UTSW 16 32,596,177 (GRCm39) missense possibly damaging 0.91
R6976:Muc4 UTSW 16 32,582,892 (GRCm39) missense possibly damaging 0.92
R6985:Muc4 UTSW 16 32,570,817 (GRCm39) missense probably benign 0.00
R7020:Muc4 UTSW 16 32,570,628 (GRCm39) nonsense probably null
R7033:Muc4 UTSW 16 32,576,698 (GRCm39) unclassified probably benign
R7098:Muc4 UTSW 16 32,577,465 (GRCm39) missense
R7123:Muc4 UTSW 16 32,569,509 (GRCm39) missense possibly damaging 0.83
R7173:Muc4 UTSW 16 32,582,862 (GRCm39) missense probably damaging 0.97
R7178:Muc4 UTSW 16 32,752,788 (GRCm38) missense unknown
R7294:Muc4 UTSW 16 32,576,835 (GRCm39) missense possibly damaging 0.53
R7318:Muc4 UTSW 16 32,575,710 (GRCm39) missense unknown
R7361:Muc4 UTSW 16 32,754,670 (GRCm38) missense probably benign 0.18
R7380:Muc4 UTSW 16 32,575,740 (GRCm39) missense unknown
R7381:Muc4 UTSW 16 32,601,285 (GRCm39) missense
R7411:Muc4 UTSW 16 32,570,140 (GRCm39) missense probably benign 0.12
R7422:Muc4 UTSW 16 32,754,689 (GRCm38) missense probably benign 0.00
R7482:Muc4 UTSW 16 32,587,324 (GRCm39) missense
R7539:Muc4 UTSW 16 32,576,770 (GRCm39) missense
R7544:Muc4 UTSW 16 32,555,016 (GRCm39) start codon destroyed probably null
R7574:Muc4 UTSW 16 32,753,411 (GRCm38) missense probably benign 0.18
R7576:Muc4 UTSW 16 32,754,500 (GRCm38) missense probably benign 0.10
R7585:Muc4 UTSW 16 32,586,076 (GRCm39) missense
R7596:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7597:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7602:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7616:Muc4 UTSW 16 32,574,161 (GRCm39) nonsense probably null
R7639:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7651:Muc4 UTSW 16 32,576,949 (GRCm39) missense
R7688:Muc4 UTSW 16 32,570,278 (GRCm39) missense possibly damaging 0.68
R7689:Muc4 UTSW 16 32,574,439 (GRCm39) missense probably benign 0.10
R7752:Muc4 UTSW 16 32,589,108 (GRCm39) missense
R7763:Muc4 UTSW 16 32,574,739 (GRCm39) missense probably benign 0.10
R7768:Muc4 UTSW 16 32,576,568 (GRCm39) missense unknown
R7787:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7789:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R7838:Muc4 UTSW 16 32,752,558 (GRCm38) nonsense probably null
R7871:Muc4 UTSW 16 32,754,935 (GRCm38) missense unknown
R7921:Muc4 UTSW 16 32,570,139 (GRCm39) missense possibly damaging 0.68
R7927:Muc4 UTSW 16 32,592,011 (GRCm39) missense
R7930:Muc4 UTSW 16 32,575,369 (GRCm39) unclassified probably benign
R8000:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R8062:Muc4 UTSW 16 32,577,123 (GRCm39) missense
R8096:Muc4 UTSW 16 32,575,764 (GRCm39) missense unknown
R8115:Muc4 UTSW 16 32,575,678 (GRCm39) missense unknown
R8162:Muc4 UTSW 16 32,569,197 (GRCm39) missense unknown
R8220:Muc4 UTSW 16 32,575,701 (GRCm39) missense unknown
R8260:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R8290:Muc4 UTSW 16 32,575,434 (GRCm39) missense probably benign 0.01
R8299:Muc4 UTSW 16 32,576,271 (GRCm39) missense unknown
R8313:Muc4 UTSW 16 32,753,423 (GRCm38) missense probably benign 0.04
R8356:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R8463:Muc4 UTSW 16 32,574,201 (GRCm39) missense probably benign 0.00
R8479:Muc4 UTSW 16 32,574,799 (GRCm39) missense possibly damaging 0.59
R8480:Muc4 UTSW 16 32,574,421 (GRCm39) missense probably benign 0.20
R8510:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R8515:Muc4 UTSW 16 32,575,629 (GRCm39) missense unknown
R8559:Muc4 UTSW 16 32,754,715 (GRCm38) missense unknown
R8685:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R8687:Muc4 UTSW 16 32,575,221 (GRCm39) missense probably benign 0.01
R8728:Muc4 UTSW 16 32,754,952 (GRCm38) missense unknown
R8754:Muc4 UTSW 16 32,602,356 (GRCm39) missense
R8845:Muc4 UTSW 16 32,576,889 (GRCm39) missense possibly damaging 0.86
R8852:Muc4 UTSW 16 32,569,461 (GRCm39) missense possibly damaging 0.66
R8863:Muc4 UTSW 16 32,570,280 (GRCm39) missense possibly damaging 0.84
R8896:Muc4 UTSW 16 32,754,673 (GRCm38) missense probably benign 0.01
R8929:Muc4 UTSW 16 32,754,017 (GRCm38) missense possibly damaging 0.53
R8929:Muc4 UTSW 16 32,575,285 (GRCm39) missense probably benign 0.00
R8990:Muc4 UTSW 16 32,574,009 (GRCm39) missense probably benign 0.01
R9018:Muc4 UTSW 16 32,582,910 (GRCm39) missense
R9034:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R9064:Muc4 UTSW 16 32,754,397 (GRCm38) missense possibly damaging 0.53
R9068:Muc4 UTSW 16 32,575,367 (GRCm39) unclassified probably benign
R9086:Muc4 UTSW 16 32,577,842 (GRCm39) missense
R9151:Muc4 UTSW 16 32,752,617 (GRCm38) missense probably benign 0.01
R9187:Muc4 UTSW 16 32,589,102 (GRCm39) missense
R9336:Muc4 UTSW 16 32,569,756 (GRCm39) missense possibly damaging 0.86
R9343:Muc4 UTSW 16 32,569,971 (GRCm39) missense possibly damaging 0.53
R9363:Muc4 UTSW 16 32,576,992 (GRCm39) missense
R9429:Muc4 UTSW 16 32,576,098 (GRCm39) missense unknown
R9570:Muc4 UTSW 16 32,569,695 (GRCm39) missense possibly damaging 0.53
R9609:Muc4 UTSW 16 32,577,234 (GRCm39) missense
R9696:Muc4 UTSW 16 32,574,712 (GRCm39) missense probably benign 0.00
R9709:Muc4 UTSW 16 32,590,644 (GRCm39) missense
R9743:Muc4 UTSW 16 32,601,194 (GRCm39) missense
R9747:Muc4 UTSW 16 32,754,698 (GRCm38) missense probably benign 0.01
RF014:Muc4 UTSW 16 32,570,676 (GRCm39) missense probably damaging 0.98
U15987:Muc4 UTSW 16 32,754,529 (GRCm38) missense probably benign 0.01
U15987:Muc4 UTSW 16 32,575,621 (GRCm39) unclassified probably benign
V5622:Muc4 UTSW 16 32,570,643 (GRCm39) missense probably benign 0.00
X0018:Muc4 UTSW 16 32,575,855 (GRCm39) unclassified probably benign
X0028:Muc4 UTSW 16 32,579,693 (GRCm39) critical splice donor site probably null
Z1088:Muc4 UTSW 16 32,576,450 (GRCm39) unclassified probably benign
Z1176:Muc4 UTSW 16 32,589,104 (GRCm39) missense possibly damaging 0.65
Z1177:Muc4 UTSW 16 32,587,767 (GRCm39) nonsense probably null
Z1177:Muc4 UTSW 16 32,595,236 (GRCm39) missense
Z1177:Muc4 UTSW 16 32,587,768 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GGACTGATGTGGGAATGTCC -3'
(R):5'- TTACTGACTGCCAAGGACTTG -3'

Sequencing Primer
(F):5'- TTCTCCTGGAAGGCTAAAAAGTGC -3'
(R):5'- TGACTGCCAAGGACTTGAATGACTC -3'
Posted On 2019-10-24