Incidental Mutation 'R7640:Cuta'
ID 590217
Institutional Source Beutler Lab
Gene Symbol Cuta
Ensembl Gene ENSMUSG00000024194
Gene Name cutA divalent cation tolerance homolog
Synonyms 0610039D01Rik, 2700094G22Rik, 1810060C03Rik, 1810022E02Rik, CutA
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 27156946-27158847 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 27157396 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 135 (V135I)
Ref Sequence ENSEMBL: ENSMUSP00000025027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025027] [ENSMUST00000073724] [ENSMUST00000114935] [ENSMUST00000177932] [ENSMUST00000194598] [ENSMUST00000201702] [ENSMUST00000229490]
AlphaFold Q9CQ89
Predicted Effect probably benign
Transcript: ENSMUST00000025027
AA Change: V135I

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025027
Gene: ENSMUSG00000024194
AA Change: V135I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
Pfam:CutA1 67 165 6.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073724
SMART Domains Protein: ENSMUSP00000073402
Gene: ENSMUSG00000024193

DomainStartEndE-ValueType
TUDOR 29 86 5.61e-11 SMART
PHD 89 140 2.81e-8 SMART
PHD 188 238 2.42e0 SMART
low complexity region 410 416 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
Pfam:Mtf2_C 523 557 7.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114935
AA Change: V112I

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110585
Gene: ENSMUSG00000024194
AA Change: V112I

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:CutA1 43 144 1.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177932
SMART Domains Protein: ENSMUSP00000137587
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193200
SMART Domains Protein: ENSMUSP00000141245
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 12 238 1.5e-10 SMART
C2 248 347 4.8e-12 SMART
RasGAP 377 714 2.1e-120 SMART
low complexity region 772 788 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
low complexity region 1025 1053 N/A INTRINSIC
low complexity region 1095 1110 N/A INTRINSIC
coiled coil region 1171 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194598
SMART Domains Protein: ENSMUSP00000141686
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 3.23e-8 SMART
C2 263 362 7.4e-10 SMART
RasGAP 392 729 3.33e-118 SMART
low complexity region 787 803 N/A INTRINSIC
low complexity region 938 973 N/A INTRINSIC
low complexity region 1040 1068 N/A INTRINSIC
low complexity region 1110 1125 N/A INTRINSIC
coiled coil region 1186 1259 N/A INTRINSIC
low complexity region 1308 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201349
SMART Domains Protein: ENSMUSP00000144666
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
RasGAP 9 346 2.2e-120 SMART
low complexity region 404 420 N/A INTRINSIC
low complexity region 555 590 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
low complexity region 727 742 N/A INTRINSIC
Blast:RasGAP 761 876 3e-21 BLAST
low complexity region 884 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201702
SMART Domains Protein: ENSMUSP00000144248
Gene: ENSMUSG00000067629

DomainStartEndE-ValueType
PH 27 253 1.5e-10 SMART
C2 263 362 4.9e-12 SMART
RasGAP 392 729 2.2e-120 SMART
low complexity region 773 789 N/A INTRINSIC
low complexity region 924 959 N/A INTRINSIC
low complexity region 1026 1054 N/A INTRINSIC
low complexity region 1096 1111 N/A INTRINSIC
coiled coil region 1171 1243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229490
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Atr T G 9: 95,789,346 (GRCm39) probably null Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Clock G T 5: 76,396,225 (GRCm39) L175M possibly damaging Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Ddx41 A T 13: 55,682,052 (GRCm39) M241K possibly damaging Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Fas A G 19: 34,284,564 (GRCm39) T24A possibly damaging Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Lamc2 A T 1: 153,012,550 (GRCm39) I708N possibly damaging Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Muc4 C A 16: 32,580,479 (GRCm39) P360T Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or5w11 A G 2: 87,459,436 (GRCm39) I94V probably benign Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pmepa1 C T 2: 173,117,956 (GRCm39) A8T probably benign Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rpap1 G A 2: 119,594,891 (GRCm39) P1372L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sema3f A T 9: 107,560,774 (GRCm39) S644R probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tlcd4 A G 3: 121,028,690 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,070 (GRCm39) D747G probably damaging Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp423 T C 8: 88,507,905 (GRCm39) K813R probably damaging Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Cuta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Cuta APN 17 27,157,438 (GRCm39) missense probably benign 0.00
R0285:Cuta UTSW 17 27,158,423 (GRCm39) critical splice donor site probably null
R6261:Cuta UTSW 17 27,158,301 (GRCm39) missense possibly damaging 0.96
R6382:Cuta UTSW 17 27,157,428 (GRCm39) missense probably benign 0.00
R6595:Cuta UTSW 17 27,157,856 (GRCm39) critical splice donor site probably null
R7421:Cuta UTSW 17 27,158,431 (GRCm39) unclassified probably benign
R9325:Cuta UTSW 17 27,158,289 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTTCCACCACACAGTGTCC -3'
(R):5'- GGAGAAATCTTCCTTTCCCAAGAC -3'

Sequencing Primer
(F):5'- AGTGTCCACCTCAGCGCTTG -3'
(R):5'- CCTCTTCAGCTATGAATGGAAAGG -3'
Posted On 2019-10-24