Incidental Mutation 'R7640:Fas'
ID 590221
Institutional Source Beutler Lab
Gene Symbol Fas
Ensembl Gene ENSMUSG00000024778
Gene Name Fas cell surface death receptor
Synonyms APO-1, Tnfrsf6, TNFR6, CD95
MMRRC Submission 045698-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.134) question?
Stock # R7640 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 34268066-34305172 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34284564 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 24 (T24A)
Ref Sequence ENSEMBL: ENSMUSP00000025691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025691] [ENSMUST00000112472]
AlphaFold P25446
PDB Structure Structure of the FAS/FADD death domain assembly [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025691
AA Change: T24A

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025691
Gene: ENSMUSG00000024778
AA Change: T24A

DomainStartEndE-ValueType
TNFR 44 78 2.43e0 SMART
TNFR 81 123 3.21e-8 SMART
TNFR 125 161 9.45e-6 SMART
transmembrane domain 170 187 N/A INTRINSIC
DEATH 212 306 2.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112472
AA Change: T24A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108091
Gene: ENSMUSG00000024778
AA Change: T24A

DomainStartEndE-ValueType
Blast:TNFR 44 61 5e-6 BLAST
SCOP:d1jmab1 44 61 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor contains a death domain. It has been shown to play a central role in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune system. The interaction of this receptor with its ligand allows the formation of a death-inducing signaling complex that includes Fas-associated death domain protein (FADD), caspase 8, and caspase 10. The autoproteolytic processing of the caspases in the complex triggers a downstream caspase cascade, and leads to apoptosis. This receptor has been also shown to activate NF-kappaB, MAPK3/ERK1, and MAPK8/JNK, and is found to be involved in transducing the proliferating signals in normal diploid fibroblast and T cells. Several alternatively spliced transcript variants have been described, some of which are candidates for nonsense-mediated mRNA decay (NMD). The isoforms lacking the transmembrane domain may negatively regulate the apoptosis mediated by the full length isoform. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mutations in this locus affect immune function and homozygotes show varying severity of lymphadenopathy, splenomegaly, lymphocytic infiltrations, elevated immunoglobulin levels, autoantibodies, impaired clonal deletion of T cells, and lupus-like disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013G24Rik A T 4: 137,181,905 (GRCm39) N20I probably damaging Het
4930558K02Rik A G 1: 161,784,718 (GRCm39) S74P probably benign Het
Abcb6 A T 1: 75,151,489 (GRCm39) probably null Het
Adamts14 C A 10: 61,081,836 (GRCm39) A234S probably benign Het
Ankrd42 A G 7: 92,268,843 (GRCm39) S167P probably benign Het
Ap3m1 T C 14: 21,088,243 (GRCm39) I272V probably benign Het
Armt1 T C 10: 4,403,572 (GRCm39) F219S probably damaging Het
Atr T G 9: 95,789,346 (GRCm39) probably null Het
Cep72 G A 13: 74,206,607 (GRCm39) Q72* probably null Het
Clock G T 5: 76,396,225 (GRCm39) L175M possibly damaging Het
Cnmd T A 14: 79,898,974 (GRCm39) Y26F possibly damaging Het
Col6a6 A T 9: 105,662,943 (GRCm39) M198K possibly damaging Het
Cuta C T 17: 27,157,396 (GRCm39) V135I probably benign Het
Ddx41 A T 13: 55,682,052 (GRCm39) M241K possibly damaging Het
Dnajc22 A G 15: 98,998,995 (GRCm39) N60S probably damaging Het
Drc3 A G 11: 60,279,730 (GRCm39) M432V probably benign Het
Dync2i2 T G 2: 29,921,780 (GRCm39) D527A probably benign Het
Eef1d C A 15: 75,774,556 (GRCm39) G368C probably damaging Het
En2 A T 5: 28,375,164 (GRCm39) K236* probably null Het
Golga2 T C 2: 32,196,251 (GRCm39) V930A probably benign Het
Gprin2 G T 14: 33,917,710 (GRCm39) A20D probably benign Het
Ighv14-4 A T 12: 114,140,064 (GRCm39) C115* probably null Het
Impdh2 T C 9: 108,442,380 (GRCm39) Y459H possibly damaging Het
Klhdc7b G T 15: 89,271,463 (GRCm39) V124L possibly damaging Het
L2hgdh A T 12: 69,768,131 (GRCm39) Y122* probably null Het
Lamc2 A T 1: 153,012,550 (GRCm39) I708N possibly damaging Het
Large2 T C 2: 92,205,050 (GRCm39) M1V probably null Het
Lrit2 T C 14: 36,794,081 (GRCm39) W382R probably damaging Het
Mcee T A 7: 64,061,716 (GRCm39) V173E probably damaging Het
Mcph1 T A 8: 18,682,342 (GRCm39) V493E probably benign Het
Mfap4 A G 11: 61,377,913 (GRCm39) N118D probably damaging Het
Mknk2 T C 10: 80,504,400 (GRCm39) S301G probably benign Het
Mlf1 G A 3: 67,300,266 (GRCm39) M94I possibly damaging Het
Mrc2 T A 11: 105,223,121 (GRCm39) S455T possibly damaging Het
Mrgprb5 T G 7: 47,818,007 (GRCm39) I243L probably benign Het
Muc4 C A 16: 32,580,479 (GRCm39) P360T Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Nscme3l T A 19: 5,553,035 (GRCm39) S249C probably damaging Het
Nts T C 10: 102,326,165 (GRCm39) Q7R possibly damaging Het
Oas1b T C 5: 120,959,479 (GRCm39) L288P probably damaging Het
Or4a66 T A 2: 88,531,230 (GRCm39) I148L probably benign Het
Or51k2 A T 7: 103,596,150 (GRCm39) I126F probably damaging Het
Or5w11 A G 2: 87,459,436 (GRCm39) I94V probably benign Het
Or8k30 A G 2: 86,339,287 (GRCm39) I161M possibly damaging Het
Otoa A G 7: 120,744,849 (GRCm39) E869G probably damaging Het
Pcdhac2 T C 18: 37,277,578 (GRCm39) L186P probably damaging Het
Plekhh2 A G 17: 84,918,204 (GRCm39) E1271G possibly damaging Het
Pmepa1 C T 2: 173,117,956 (GRCm39) A8T probably benign Het
Pramel24 T C 4: 143,453,276 (GRCm39) V128A probably benign Het
Rc3h2 A G 2: 37,267,861 (GRCm39) probably null Het
Rlf T A 4: 121,003,998 (GRCm39) M1771L possibly damaging Het
Rpap1 G A 2: 119,594,891 (GRCm39) P1372L possibly damaging Het
Rragd A T 4: 32,983,527 (GRCm39) D22V probably benign Het
Sema3f A T 9: 107,560,774 (GRCm39) S644R probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Spata31h1 T A 10: 82,130,490 (GRCm39) N840I probably damaging Het
Specc1l T A 10: 75,093,703 (GRCm39) N717K probably damaging Het
Sphkap C T 1: 83,256,649 (GRCm39) D367N possibly damaging Het
Tbc1d21 C T 9: 58,268,544 (GRCm39) V272M probably damaging Het
Tlcd4 A G 3: 121,028,690 (GRCm39) probably null Het
Tmem132c A G 5: 127,640,070 (GRCm39) D747G probably damaging Het
Trim2 C A 3: 84,098,213 (GRCm39) V372F probably benign Het
Ttc34 A G 4: 154,945,841 (GRCm39) T292A probably benign Het
Ube3b A G 5: 114,553,384 (GRCm39) T919A probably benign Het
Zfhx4 T C 3: 5,477,540 (GRCm39) I3385T probably benign Het
Zfp423 T C 8: 88,507,905 (GRCm39) K813R probably damaging Het
Zfp850 T C 7: 27,688,634 (GRCm39) T525A probably benign Het
Zfp873 T C 10: 81,896,109 (GRCm39) I280T possibly damaging Het
Zkscan7 A G 9: 122,725,121 (GRCm39) T697A possibly damaging Het
Other mutations in Fas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fas APN 19 34,296,018 (GRCm39) missense probably damaging 1.00
IGL01677:Fas APN 19 34,296,218 (GRCm39) missense probably benign 0.09
IGL01834:Fas APN 19 34,296,003 (GRCm39) missense probably benign 0.33
IGL02130:Fas APN 19 34,292,695 (GRCm39) missense probably benign 0.01
IGL02424:Fas APN 19 34,304,434 (GRCm39) missense probably damaging 1.00
IGL02532:Fas APN 19 34,293,999 (GRCm39) missense probably damaging 0.99
IGL02569:Fas APN 19 34,297,962 (GRCm39) missense possibly damaging 0.93
amarena UTSW 19 34,296,049 (GRCm39) missense probably benign 0.01
bing UTSW 19 34,293,969 (GRCm39) missense probably damaging 1.00
cherry UTSW 19 34,304,540 (GRCm39) missense probably damaging 0.99
P0021:Fas UTSW 19 34,284,610 (GRCm39) missense probably damaging 0.98
R0525:Fas UTSW 19 34,296,727 (GRCm39) missense probably damaging 1.00
R0588:Fas UTSW 19 34,304,540 (GRCm39) missense probably damaging 0.99
R1465:Fas UTSW 19 34,294,013 (GRCm39) missense probably damaging 1.00
R1465:Fas UTSW 19 34,294,013 (GRCm39) missense probably damaging 1.00
R2077:Fas UTSW 19 34,297,953 (GRCm39) splice site probably benign
R2283:Fas UTSW 19 34,284,649 (GRCm39) missense probably damaging 1.00
R4154:Fas UTSW 19 34,296,228 (GRCm39) missense possibly damaging 0.72
R5252:Fas UTSW 19 34,294,043 (GRCm39) missense probably damaging 0.99
R5943:Fas UTSW 19 34,297,987 (GRCm39) critical splice donor site probably null
R6474:Fas UTSW 19 34,293,969 (GRCm39) missense probably damaging 1.00
R6837:Fas UTSW 19 34,284,564 (GRCm39) missense probably damaging 0.97
R8507:Fas UTSW 19 34,304,626 (GRCm39) missense probably benign 0.00
R8837:Fas UTSW 19 34,296,049 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCCACAGGGTACTCATCTC -3'
(R):5'- ATAGCTGCATAATGGTCCAACAC -3'

Sequencing Primer
(F):5'- AGGGTACTCATCTCCTGGCAAC -3'
(R):5'- GCATAATGGTCCAACACATTCTTC -3'
Posted On 2019-10-24