Incidental Mutation 'R7641:Dnah14'
ID 590224
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms Dnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission 045699-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R7641 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181576559-181815774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 181707533 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 2355 (I2355L)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000208001
AA Change: I2355L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,519,307 (GRCm38) Q641L probably benign Het
Aknad1 A T 3: 108,771,975 (GRCm38) H474L probably benign Het
Alkal1 A T 1: 6,389,488 (GRCm38) Y96F probably damaging Het
Cars1 A G 7: 143,587,103 (GRCm38) probably null Het
Chtf18 A T 17: 25,722,275 (GRCm38) probably null Het
Cog2 C A 8: 124,537,882 (GRCm38) N333K probably damaging Het
Col6a5 T A 9: 105,881,426 (GRCm38) R2194* probably null Het
Dock8 G A 19: 25,174,333 (GRCm38) probably null Het
Dpy19l3 A C 7: 35,695,309 (GRCm38) D601E probably damaging Het
Elf1 G A 14: 79,570,723 (GRCm38) G205E probably damaging Het
Fsip2 A T 2: 82,986,912 (GRCm38) K4330* probably null Het
Gm6525 A T 3: 84,174,843 (GRCm38) T24S probably benign Het
Golga4 G T 9: 118,557,575 (GRCm38) R1255L probably benign Het
Gpn2 A T 4: 133,588,659 (GRCm38) Q243L probably null Het
Grb10 T C 11: 11,933,492 (GRCm38) K588E possibly damaging Het
Gys1 T C 7: 45,455,071 (GRCm38) S641P probably damaging Het
H2-M5 T A 17: 36,987,431 (GRCm38) M331L probably benign Het
Ighv6-6 T A 12: 114,435,217 (GRCm38) I10L probably benign Het
Jmy C T 13: 93,442,599 (GRCm38) R675Q probably damaging Het
Lonp2 A T 8: 86,665,758 (GRCm38) Q484L probably benign Het
Map3k20 T A 2: 72,398,361 (GRCm38) L308H probably damaging Het
Mep1b T C 18: 21,094,977 (GRCm38) F546L possibly damaging Het
Mier1 A G 4: 103,139,440 (GRCm38) E133G possibly damaging Het
Msh3 C A 13: 92,212,503 (GRCm38) V1074L probably benign Het
Muc6 A T 7: 141,639,825 (GRCm38) L1645Q unknown Het
Nat10 G A 2: 103,743,090 (GRCm38) A354V probably damaging Het
Or8b12i A G 9: 20,171,253 (GRCm38) L106P possibly damaging Het
Pdyn A T 2: 129,689,828 (GRCm38) V14E possibly damaging Het
Prdm16 T A 4: 154,345,444 (GRCm38) H356L probably damaging Het
Rasa3 A G 8: 13,584,961 (GRCm38) C453R probably benign Het
Rasgrf2 C T 13: 92,131,406 (GRCm38) S30N possibly damaging Het
Rlf A G 4: 121,159,196 (GRCm38) S315P probably damaging Het
Rusc2 C T 4: 43,425,335 (GRCm38) R1147W possibly damaging Het
Sacs T A 14: 61,202,871 (GRCm38) Y789N probably damaging Het
Sap130 T C 18: 31,653,623 (GRCm38) L289P probably damaging Het
Septin3 A G 15: 82,290,782 (GRCm38) Y308C probably damaging Het
Slc2a12 A G 10: 22,693,994 (GRCm38) D528G probably damaging Het
Slc2a13 A G 15: 91,272,156 (GRCm38) *638Q probably null Het
Smchd1 T A 17: 71,390,479 (GRCm38) E1155D probably benign Het
Sorcs2 G A 5: 36,397,952 (GRCm38) R32C probably damaging Het
Sp110 G A 1: 85,579,092 (GRCm38) R417C probably benign Het
Tonsl C T 15: 76,633,652 (GRCm38) D650N probably damaging Het
Tti1 A T 2: 158,009,029 (GRCm38) F97I possibly damaging Het
Ttn T C 2: 76,742,210 (GRCm38) Q26113R possibly damaging Het
Unc5d A T 8: 28,719,975 (GRCm38) N444K probably damaging Het
Usp17la A T 7: 104,861,447 (GRCm38) K420* probably null Het
Vmn2r114 T C 17: 23,308,203 (GRCm38) N452D possibly damaging Het
Vps16 T C 2: 130,440,528 (GRCm38) V427A probably benign Het
Wdr5b T A 16: 36,042,342 (GRCm38) V277D probably damaging Het
Zan T A 5: 137,467,108 (GRCm38) M462L possibly damaging Het
Zfp40 A G 17: 23,178,283 (GRCm38) V80A possibly damaging Het
Zfp930 A T 8: 69,228,685 (GRCm38) H344L probably damaging Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181,752,046 (GRCm38) missense probably benign 0.17
IGL01764:Dnah14 APN 1 181,744,777 (GRCm38) missense probably benign 0.00
IGL03218:Dnah14 APN 1 181,755,269 (GRCm38) missense probably benign 0.02
IGL03290:Dnah14 APN 1 181,763,978 (GRCm38) splice site probably benign
IGL03384:Dnah14 APN 1 181,745,949 (GRCm38) missense probably benign 0.03
R0009:Dnah14 UTSW 1 181,769,407 (GRCm38) splice site probably benign
R0125:Dnah14 UTSW 1 181,752,063 (GRCm38) missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181,744,747 (GRCm38) missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181,752,145 (GRCm38) missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181,752,145 (GRCm38) missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181,752,145 (GRCm38) missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181,750,177 (GRCm38) missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181,763,960 (GRCm38) missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181,752,562 (GRCm38) missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181,755,241 (GRCm38) critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181,757,223 (GRCm38) missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181,757,234 (GRCm38) missense probably benign 0.01
R5424:Dnah14 UTSW 1 181,763,310 (GRCm38) missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181,741,159 (GRCm38) missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181,770,105 (GRCm38) missense probably benign 0.00
R6052:Dnah14 UTSW 1 181,666,487 (GRCm38) missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181,709,051 (GRCm38) missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181,750,154 (GRCm38) missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181,621,833 (GRCm38) missense probably benign 0.13
R6145:Dnah14 UTSW 1 181,666,417 (GRCm38) missense probably benign 0.00
R6163:Dnah14 UTSW 1 181,666,361 (GRCm38) missense probably benign 0.33
R6246:Dnah14 UTSW 1 181,680,888 (GRCm38) missense probably benign 0.00
R6302:Dnah14 UTSW 1 181,601,206 (GRCm38) missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181,585,024 (GRCm38) frame shift probably null
R6326:Dnah14 UTSW 1 181,783,556 (GRCm38) missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181,626,720 (GRCm38) missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181,755,386 (GRCm38) splice site probably null
R6376:Dnah14 UTSW 1 181,605,894 (GRCm38) missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181,651,202 (GRCm38) critical splice donor site probably null
R6433:Dnah14 UTSW 1 181,651,657 (GRCm38) missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181,783,705 (GRCm38) missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181,744,768 (GRCm38) missense probably benign 0.26
R6523:Dnah14 UTSW 1 181,643,621 (GRCm38) missense probably benign 0.00
R6529:Dnah14 UTSW 1 181,666,469 (GRCm38) missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181,584,985 (GRCm38) missense unknown
R6546:Dnah14 UTSW 1 181,738,987 (GRCm38) missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181,593,452 (GRCm38) missense probably benign 0.07
R6762:Dnah14 UTSW 1 181,757,259 (GRCm38) missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181,641,405 (GRCm38) missense probably benign 0.21
R6849:Dnah14 UTSW 1 181,808,945 (GRCm38) missense probably benign 0.00
R6877:Dnah14 UTSW 1 181,628,432 (GRCm38) missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181,750,183 (GRCm38) missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181,585,066 (GRCm38) missense probably benign 0.04
R6924:Dnah14 UTSW 1 181,627,952 (GRCm38) missense probably benign 0.04
R6957:Dnah14 UTSW 1 181,785,175 (GRCm38) missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181,648,230 (GRCm38) missense probably benign 0.00
R7018:Dnah14 UTSW 1 181,626,944 (GRCm38) missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181,623,003 (GRCm38) missense probably benign 0.01
R7058:Dnah14 UTSW 1 181,698,049 (GRCm38) missense probably benign 0.00
R7068:Dnah14 UTSW 1 181,769,790 (GRCm38) missense probably benign 0.35
R7115:Dnah14 UTSW 1 181,720,145 (GRCm38) missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181,745,958 (GRCm38) nonsense probably null
R7165:Dnah14 UTSW 1 181,704,535 (GRCm38) missense probably benign 0.00
R7169:Dnah14 UTSW 1 181,702,365 (GRCm38) missense probably benign 0.00
R7184:Dnah14 UTSW 1 181,704,529 (GRCm38) nonsense probably null
R7232:Dnah14 UTSW 1 181,757,363 (GRCm38) missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181,706,744 (GRCm38) missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181,685,807 (GRCm38) missense probably benign 0.41
R7290:Dnah14 UTSW 1 181,628,174 (GRCm38) missense probably benign 0.20
R7314:Dnah14 UTSW 1 181,785,254 (GRCm38) splice site probably null
R7326:Dnah14 UTSW 1 181,598,403 (GRCm38) missense probably benign 0.02
R7336:Dnah14 UTSW 1 181,797,734 (GRCm38) missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181,690,524 (GRCm38) splice site probably null
R7371:Dnah14 UTSW 1 181,626,885 (GRCm38) missense probably benign 0.05
R7376:Dnah14 UTSW 1 181,763,402 (GRCm38) missense probably benign 0.03
R7418:Dnah14 UTSW 1 181,616,742 (GRCm38) missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181,752,139 (GRCm38) missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181,628,067 (GRCm38) missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181,770,054 (GRCm38) missense probably benign 0.26
R7663:Dnah14 UTSW 1 181,752,155 (GRCm38) splice site probably null
R7674:Dnah14 UTSW 1 181,707,533 (GRCm38) missense probably benign 0.01
R7680:Dnah14 UTSW 1 181,685,800 (GRCm38) missense probably benign 0.15
R7709:Dnah14 UTSW 1 181,702,484 (GRCm38) critical splice donor site probably null
R7842:Dnah14 UTSW 1 181,627,898 (GRCm38) missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181,616,759 (GRCm38) missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181,783,574 (GRCm38) missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181,648,311 (GRCm38) missense probably benign 0.05
R8042:Dnah14 UTSW 1 181,643,631 (GRCm38) critical splice donor site probably null
R8071:Dnah14 UTSW 1 181,615,894 (GRCm38) missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181,766,232 (GRCm38) missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181,806,032 (GRCm38) nonsense probably null
R8139:Dnah14 UTSW 1 181,755,288 (GRCm38) missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181,657,033 (GRCm38) missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181,688,205 (GRCm38) missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181,690,101 (GRCm38) missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181,795,545 (GRCm38) missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181,795,545 (GRCm38) missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181,664,865 (GRCm38) missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181,744,792 (GRCm38) missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181,773,811 (GRCm38) missense probably benign 0.03
R8289:Dnah14 UTSW 1 181,716,215 (GRCm38) nonsense probably null
R8323:Dnah14 UTSW 1 181,704,544 (GRCm38) missense probably benign 0.01
R8442:Dnah14 UTSW 1 181,741,284 (GRCm38) missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181,806,012 (GRCm38) missense
R8507:Dnah14 UTSW 1 181,641,414 (GRCm38) missense probably benign 0.02
R8509:Dnah14 UTSW 1 181,814,655 (GRCm38) missense
R8520:Dnah14 UTSW 1 181,653,638 (GRCm38) missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181,664,946 (GRCm38) missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181,666,011 (GRCm38) nonsense probably null
R8710:Dnah14 UTSW 1 181,690,311 (GRCm38) missense probably benign 0.04
R8752:Dnah14 UTSW 1 181,628,016 (GRCm38) missense probably benign 0.00
R8792:Dnah14 UTSW 1 181,814,624 (GRCm38) missense
R8797:Dnah14 UTSW 1 181,637,847 (GRCm38) missense probably benign 0.19
R8821:Dnah14 UTSW 1 181,792,004 (GRCm38) nonsense probably null
R8834:Dnah14 UTSW 1 181,616,750 (GRCm38) missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181,725,498 (GRCm38) missense probably benign 0.01
R8925:Dnah14 UTSW 1 181,680,756 (GRCm38) missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181,680,756 (GRCm38) missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181,622,723 (GRCm38) missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181,769,760 (GRCm38) missense probably benign 0.33
R9169:Dnah14 UTSW 1 181,605,816 (GRCm38) missense probably benign 0.06
R9199:Dnah14 UTSW 1 181,651,001 (GRCm38) missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181,801,287 (GRCm38) missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181,616,640 (GRCm38) critical splice donor site probably null
R9271:Dnah14 UTSW 1 181,769,760 (GRCm38) missense probably benign 0.33
R9282:Dnah14 UTSW 1 181,814,512 (GRCm38) missense
R9350:Dnah14 UTSW 1 181,734,804 (GRCm38) missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181,709,033 (GRCm38) missense probably benign 0.01
R9436:Dnah14 UTSW 1 181,680,783 (GRCm38) missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181,797,746 (GRCm38) missense probably benign 0.01
R9484:Dnah14 UTSW 1 181,690,208 (GRCm38) missense probably benign 0.45
R9486:Dnah14 UTSW 1 181,680,929 (GRCm38) missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181,593,427 (GRCm38) critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181,593,427 (GRCm38) critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181,674,442 (GRCm38) missense probably benign 0.16
R9654:Dnah14 UTSW 1 181,766,339 (GRCm38) missense probably benign 0.01
R9681:Dnah14 UTSW 1 181,734,849 (GRCm38) missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181,598,944 (GRCm38) missense probably benign 0.01
R9687:Dnah14 UTSW 1 181,598,413 (GRCm38) missense probably benign 0.01
R9718:Dnah14 UTSW 1 181,622,979 (GRCm38) missense probably benign 0.08
R9751:Dnah14 UTSW 1 181,792,045 (GRCm38) missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181,685,784 (GRCm38) missense probably benign 0.03
RF007:Dnah14 UTSW 1 181,685,809 (GRCm38) missense probably benign 0.00
RF012:Dnah14 UTSW 1 181,627,898 (GRCm38) missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181,757,351 (GRCm38) missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181,690,320 (GRCm38) missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181,766,304 (GRCm38) missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181,763,334 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACAGTGGGAAAGTCTAGAACCATC -3'
(R):5'- AGTTAGCGTACTCAGGTGGC -3'

Sequencing Primer
(F):5'- CGGAGCACTGTCATTTAAAGGTC -3'
(R):5'- TACTCAGGTGGCGCAGAG -3'
Posted On 2019-10-24