Incidental Mutation 'R7641:Vps16'
ID 590230
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms 1810074M16Rik
MMRRC Submission 045699-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R7641 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 130266259-130286189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 130282448 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 427 (V427A)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000028900
AA Change: V427A

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: V427A

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Meta Mutation Damage Score 0.6860 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,657,370 (GRCm39) Q641L probably benign Het
Aknad1 A T 3: 108,679,291 (GRCm39) H474L probably benign Het
Alkal1 A T 1: 6,459,712 (GRCm39) Y96F probably damaging Het
Cars1 A G 7: 143,140,840 (GRCm39) probably null Het
Chtf18 A T 17: 25,941,249 (GRCm39) probably null Het
Cog2 C A 8: 125,264,621 (GRCm39) N333K probably damaging Het
Col6a5 T A 9: 105,758,625 (GRCm39) R2194* probably null Het
Dnah14 A T 1: 181,535,098 (GRCm39) I2355L probably benign Het
Dock8 G A 19: 25,151,697 (GRCm39) probably null Het
Dpy19l3 A C 7: 35,394,734 (GRCm39) D601E probably damaging Het
Elf1 G A 14: 79,808,163 (GRCm39) G205E probably damaging Het
Fsip2 A T 2: 82,817,256 (GRCm39) K4330* probably null Het
Gm6525 A T 3: 84,082,150 (GRCm39) T24S probably benign Het
Golga4 G T 9: 118,386,643 (GRCm39) R1255L probably benign Het
Gpn2 A T 4: 133,315,970 (GRCm39) Q243L probably null Het
Grb10 T C 11: 11,883,492 (GRCm39) K588E possibly damaging Het
Gys1 T C 7: 45,104,495 (GRCm39) S641P probably damaging Het
H2-M5 T A 17: 37,298,323 (GRCm39) M331L probably benign Het
Ighv6-6 T A 12: 114,398,837 (GRCm39) I10L probably benign Het
Jmy C T 13: 93,579,107 (GRCm39) R675Q probably damaging Het
Lonp2 A T 8: 87,392,386 (GRCm39) Q484L probably benign Het
Map3k20 T A 2: 72,228,705 (GRCm39) L308H probably damaging Het
Mep1b T C 18: 21,228,034 (GRCm39) F546L possibly damaging Het
Mier1 A G 4: 102,996,637 (GRCm39) E133G possibly damaging Het
Msh3 C A 13: 92,349,011 (GRCm39) V1074L probably benign Het
Muc6 A T 7: 141,224,247 (GRCm39) L1645Q unknown Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Or8b12i A G 9: 20,082,549 (GRCm39) L106P possibly damaging Het
Pdyn A T 2: 129,531,748 (GRCm39) V14E possibly damaging Het
Prdm16 T A 4: 154,429,901 (GRCm39) H356L probably damaging Het
Rasa3 A G 8: 13,634,961 (GRCm39) C453R probably benign Het
Rasgrf2 C T 13: 92,267,914 (GRCm39) S30N possibly damaging Het
Rlf A G 4: 121,016,393 (GRCm39) S315P probably damaging Het
Rusc2 C T 4: 43,425,335 (GRCm39) R1147W possibly damaging Het
Sacs T A 14: 61,440,320 (GRCm39) Y789N probably damaging Het
Sap130 T C 18: 31,786,676 (GRCm39) L289P probably damaging Het
Septin3 A G 15: 82,174,983 (GRCm39) Y308C probably damaging Het
Slc2a12 A G 10: 22,569,893 (GRCm39) D528G probably damaging Het
Slc2a13 A G 15: 91,156,359 (GRCm39) *638Q probably null Het
Smchd1 T A 17: 71,697,474 (GRCm39) E1155D probably benign Het
Sorcs2 G A 5: 36,555,296 (GRCm39) R32C probably damaging Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Tonsl C T 15: 76,517,852 (GRCm39) D650N probably damaging Het
Tti1 A T 2: 157,850,949 (GRCm39) F97I possibly damaging Het
Ttn T C 2: 76,572,554 (GRCm39) Q26113R possibly damaging Het
Unc5d A T 8: 29,210,003 (GRCm39) N444K probably damaging Het
Usp17la A T 7: 104,510,654 (GRCm39) K420* probably null Het
Vmn2r114 T C 17: 23,527,177 (GRCm39) N452D possibly damaging Het
Wdr5b T A 16: 35,862,712 (GRCm39) V277D probably damaging Het
Zan T A 5: 137,465,370 (GRCm39) M462L possibly damaging Het
Zfp40 A G 17: 23,397,257 (GRCm39) V80A possibly damaging Het
Zfp930 A T 8: 69,681,337 (GRCm39) H344L probably damaging Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130,279,616 (GRCm39) missense probably benign 0.19
IGL01400:Vps16 APN 2 130,280,273 (GRCm39) missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130,280,314 (GRCm39) missense probably damaging 0.97
IGL02011:Vps16 APN 2 130,283,399 (GRCm39) missense probably benign 0.04
IGL02192:Vps16 APN 2 130,282,852 (GRCm39) missense probably damaging 0.98
IGL02220:Vps16 APN 2 130,283,573 (GRCm39) missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130,281,636 (GRCm39) critical splice donor site probably null
R0427:Vps16 UTSW 2 130,280,770 (GRCm39) missense probably benign 0.00
R0507:Vps16 UTSW 2 130,279,632 (GRCm39) critical splice donor site probably null
R1550:Vps16 UTSW 2 130,282,260 (GRCm39) missense probably benign 0.09
R1789:Vps16 UTSW 2 130,285,520 (GRCm39) missense probably benign 0.42
R3895:Vps16 UTSW 2 130,280,596 (GRCm39) missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130,284,514 (GRCm39) missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130,281,832 (GRCm39) missense probably damaging 1.00
R4555:Vps16 UTSW 2 130,285,496 (GRCm39) missense probably damaging 1.00
R4569:Vps16 UTSW 2 130,284,124 (GRCm39) missense probably benign
R4803:Vps16 UTSW 2 130,280,030 (GRCm39) missense probably benign 0.27
R4835:Vps16 UTSW 2 130,280,220 (GRCm39) splice site probably benign
R5022:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5023:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5057:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5158:Vps16 UTSW 2 130,283,199 (GRCm39) missense probably damaging 1.00
R5177:Vps16 UTSW 2 130,285,288 (GRCm39) nonsense probably null
R5540:Vps16 UTSW 2 130,284,305 (GRCm39) missense probably benign 0.00
R5680:Vps16 UTSW 2 130,282,244 (GRCm39) missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130,281,011 (GRCm39) nonsense probably null
R5690:Vps16 UTSW 2 130,281,011 (GRCm39) nonsense probably null
R5926:Vps16 UTSW 2 130,285,476 (GRCm39) missense probably damaging 0.97
R5992:Vps16 UTSW 2 130,266,369 (GRCm39) critical splice donor site probably null
R6135:Vps16 UTSW 2 130,280,573 (GRCm39) missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130,285,304 (GRCm39) missense probably damaging 1.00
R6898:Vps16 UTSW 2 130,279,601 (GRCm39) missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130,280,099 (GRCm39) missense probably damaging 1.00
R7487:Vps16 UTSW 2 130,280,977 (GRCm39) nonsense probably null
R7720:Vps16 UTSW 2 130,283,623 (GRCm39) nonsense probably null
R8246:Vps16 UTSW 2 130,280,793 (GRCm39) missense probably damaging 1.00
R8363:Vps16 UTSW 2 130,284,161 (GRCm39) missense probably benign 0.08
R9092:Vps16 UTSW 2 130,281,593 (GRCm39) missense probably damaging 0.99
R9128:Vps16 UTSW 2 130,266,319 (GRCm39) missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130,283,823 (GRCm39) critical splice donor site probably null
R9406:Vps16 UTSW 2 130,283,425 (GRCm39) critical splice donor site probably null
R9508:Vps16 UTSW 2 130,284,361 (GRCm39) missense possibly damaging 0.94
R9800:Vps16 UTSW 2 130,282,405 (GRCm39) missense probably benign 0.02
RF021:Vps16 UTSW 2 130,280,129 (GRCm39) missense probably benign 0.09
Z1177:Vps16 UTSW 2 130,283,346 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGCAAAAGAGTCTGCTCAG -3'
(R):5'- TGTCTAGCAGCACCTGGATG -3'

Sequencing Primer
(F):5'- CAAAAGAGTCTGCTCAGGGTTG -3'
(R):5'- CCTGGATGGTGAGCTGC -3'
Posted On 2019-10-24