Incidental Mutation 'R7641:Rusc2'
ID 590234
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene Name RUN and SH3 domain containing 2
Synonyms
MMRRC Submission 045699-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.205) question?
Stock # R7641 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 43381979-43427088 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43425335 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1147 (R1147W)
Ref Sequence ENSEMBL: ENSMUSP00000038379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000052829] [ENSMUST00000098106] [ENSMUST00000107928] [ENSMUST00000107929] [ENSMUST00000131668] [ENSMUST00000149221] [ENSMUST00000149676] [ENSMUST00000171134] [ENSMUST00000173682]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000035645
AA Change: R1147W

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: R1147W

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052829
SMART Domains Protein: ENSMUSP00000058980
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 47 2.9e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098106
AA Change: R1147W

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: R1147W

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107928
SMART Domains Protein: ENSMUSP00000103561
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.3e-20 PFAM
Pfam:DUF2475 212 251 6.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107929
SMART Domains Protein: ENSMUSP00000103562
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 1.5e-20 PFAM
Pfam:DUF2475 232 271 7.7e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131668
AA Change: R1147W

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: R1147W

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149221
Predicted Effect probably benign
Transcript: ENSMUST00000149676
Predicted Effect probably benign
Transcript: ENSMUST00000155080
Predicted Effect probably benign
Transcript: ENSMUST00000171134
SMART Domains Protein: ENSMUSP00000127145
Gene: ENSMUSG00000042788

DomainStartEndE-ValueType
Pfam:DUF2475 15 76 7.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173682
SMART Domains Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969

DomainStartEndE-ValueType
low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 685 703 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,657,370 (GRCm39) Q641L probably benign Het
Aknad1 A T 3: 108,679,291 (GRCm39) H474L probably benign Het
Alkal1 A T 1: 6,459,712 (GRCm39) Y96F probably damaging Het
Cars1 A G 7: 143,140,840 (GRCm39) probably null Het
Chtf18 A T 17: 25,941,249 (GRCm39) probably null Het
Cog2 C A 8: 125,264,621 (GRCm39) N333K probably damaging Het
Col6a5 T A 9: 105,758,625 (GRCm39) R2194* probably null Het
Dnah14 A T 1: 181,535,098 (GRCm39) I2355L probably benign Het
Dock8 G A 19: 25,151,697 (GRCm39) probably null Het
Dpy19l3 A C 7: 35,394,734 (GRCm39) D601E probably damaging Het
Elf1 G A 14: 79,808,163 (GRCm39) G205E probably damaging Het
Fsip2 A T 2: 82,817,256 (GRCm39) K4330* probably null Het
Gm6525 A T 3: 84,082,150 (GRCm39) T24S probably benign Het
Golga4 G T 9: 118,386,643 (GRCm39) R1255L probably benign Het
Gpn2 A T 4: 133,315,970 (GRCm39) Q243L probably null Het
Grb10 T C 11: 11,883,492 (GRCm39) K588E possibly damaging Het
Gys1 T C 7: 45,104,495 (GRCm39) S641P probably damaging Het
H2-M5 T A 17: 37,298,323 (GRCm39) M331L probably benign Het
Ighv6-6 T A 12: 114,398,837 (GRCm39) I10L probably benign Het
Jmy C T 13: 93,579,107 (GRCm39) R675Q probably damaging Het
Lonp2 A T 8: 87,392,386 (GRCm39) Q484L probably benign Het
Map3k20 T A 2: 72,228,705 (GRCm39) L308H probably damaging Het
Mep1b T C 18: 21,228,034 (GRCm39) F546L possibly damaging Het
Mier1 A G 4: 102,996,637 (GRCm39) E133G possibly damaging Het
Msh3 C A 13: 92,349,011 (GRCm39) V1074L probably benign Het
Muc6 A T 7: 141,224,247 (GRCm39) L1645Q unknown Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Or8b12i A G 9: 20,082,549 (GRCm39) L106P possibly damaging Het
Pdyn A T 2: 129,531,748 (GRCm39) V14E possibly damaging Het
Prdm16 T A 4: 154,429,901 (GRCm39) H356L probably damaging Het
Rasa3 A G 8: 13,634,961 (GRCm39) C453R probably benign Het
Rasgrf2 C T 13: 92,267,914 (GRCm39) S30N possibly damaging Het
Rlf A G 4: 121,016,393 (GRCm39) S315P probably damaging Het
Sacs T A 14: 61,440,320 (GRCm39) Y789N probably damaging Het
Sap130 T C 18: 31,786,676 (GRCm39) L289P probably damaging Het
Septin3 A G 15: 82,174,983 (GRCm39) Y308C probably damaging Het
Slc2a12 A G 10: 22,569,893 (GRCm39) D528G probably damaging Het
Slc2a13 A G 15: 91,156,359 (GRCm39) *638Q probably null Het
Smchd1 T A 17: 71,697,474 (GRCm39) E1155D probably benign Het
Sorcs2 G A 5: 36,555,296 (GRCm39) R32C probably damaging Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Tonsl C T 15: 76,517,852 (GRCm39) D650N probably damaging Het
Tti1 A T 2: 157,850,949 (GRCm39) F97I possibly damaging Het
Ttn T C 2: 76,572,554 (GRCm39) Q26113R possibly damaging Het
Unc5d A T 8: 29,210,003 (GRCm39) N444K probably damaging Het
Usp17la A T 7: 104,510,654 (GRCm39) K420* probably null Het
Vmn2r114 T C 17: 23,527,177 (GRCm39) N452D possibly damaging Het
Vps16 T C 2: 130,282,448 (GRCm39) V427A probably benign Het
Wdr5b T A 16: 35,862,712 (GRCm39) V277D probably damaging Het
Zan T A 5: 137,465,370 (GRCm39) M462L possibly damaging Het
Zfp40 A G 17: 23,397,257 (GRCm39) V80A possibly damaging Het
Zfp930 A T 8: 69,681,337 (GRCm39) H344L probably damaging Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43,426,116 (GRCm39) missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43,416,434 (GRCm39) missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43,415,840 (GRCm39) missense probably benign 0.08
IGL01628:Rusc2 APN 4 43,425,729 (GRCm39) missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43,415,738 (GRCm39) missense probably benign 0.02
IGL02030:Rusc2 APN 4 43,416,095 (GRCm39) missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43,425,668 (GRCm39) missense probably benign
IGL02115:Rusc2 APN 4 43,426,136 (GRCm39) splice site probably benign
IGL02122:Rusc2 APN 4 43,421,685 (GRCm39) missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43,425,351 (GRCm39) missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43,425,351 (GRCm39) missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43,415,545 (GRCm39) missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43,416,376 (GRCm39) missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43,425,806 (GRCm39) missense probably benign 0.00
P0026:Rusc2 UTSW 4 43,415,840 (GRCm39) missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43,424,009 (GRCm39) missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43,424,100 (GRCm39) splice site probably benign
R0068:Rusc2 UTSW 4 43,424,100 (GRCm39) splice site probably benign
R0114:Rusc2 UTSW 4 43,422,055 (GRCm39) missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43,423,954 (GRCm39) missense probably damaging 1.00
R0471:Rusc2 UTSW 4 43,425,486 (GRCm39) missense probably damaging 0.99
R1381:Rusc2 UTSW 4 43,416,137 (GRCm39) missense probably damaging 1.00
R1413:Rusc2 UTSW 4 43,416,568 (GRCm39) missense probably benign 0.00
R1416:Rusc2 UTSW 4 43,421,617 (GRCm39) missense possibly damaging 0.86
R1731:Rusc2 UTSW 4 43,426,046 (GRCm39) missense probably benign
R1864:Rusc2 UTSW 4 43,421,719 (GRCm39) missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43,421,749 (GRCm39) missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43,415,212 (GRCm39) missense probably benign 0.06
R2212:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43,416,260 (GRCm39) missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43,415,456 (GRCm39) missense probably benign 0.28
R2886:Rusc2 UTSW 4 43,415,456 (GRCm39) missense probably benign 0.28
R3412:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43,415,935 (GRCm39) missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43,416,424 (GRCm39) missense probably benign 0.45
R4135:Rusc2 UTSW 4 43,425,563 (GRCm39) missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43,415,533 (GRCm39) missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43,416,080 (GRCm39) missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43,423,942 (GRCm39) missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43,415,926 (GRCm39) missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43,415,240 (GRCm39) missense probably benign 0.05
R5131:Rusc2 UTSW 4 43,414,948 (GRCm39) missense probably benign 0.03
R5177:Rusc2 UTSW 4 43,421,805 (GRCm39) splice site probably null
R5540:Rusc2 UTSW 4 43,423,975 (GRCm39) missense probably damaging 1.00
R5561:Rusc2 UTSW 4 43,415,932 (GRCm39) nonsense probably null
R5628:Rusc2 UTSW 4 43,425,348 (GRCm39) missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43,425,758 (GRCm39) missense probably benign 0.06
R6129:Rusc2 UTSW 4 43,424,271 (GRCm39) missense probably damaging 1.00
R6362:Rusc2 UTSW 4 43,416,416 (GRCm39) missense probably benign 0.30
R6633:Rusc2 UTSW 4 43,414,852 (GRCm39) missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43,422,846 (GRCm39) missense probably benign 0.35
R7491:Rusc2 UTSW 4 43,426,528 (GRCm39) missense probably damaging 1.00
R7698:Rusc2 UTSW 4 43,414,900 (GRCm39) nonsense probably null
R7710:Rusc2 UTSW 4 43,416,119 (GRCm39) missense probably benign 0.07
R8052:Rusc2 UTSW 4 43,421,851 (GRCm39) missense probably benign
R8061:Rusc2 UTSW 4 43,422,492 (GRCm39) missense probably damaging 1.00
R8127:Rusc2 UTSW 4 43,423,747 (GRCm39) missense possibly damaging 0.54
R8319:Rusc2 UTSW 4 43,425,378 (GRCm39) missense probably damaging 1.00
R8355:Rusc2 UTSW 4 43,422,846 (GRCm39) missense probably benign 0.35
R8397:Rusc2 UTSW 4 43,424,206 (GRCm39) missense possibly damaging 0.95
R8455:Rusc2 UTSW 4 43,422,846 (GRCm39) missense probably benign 0.35
R8553:Rusc2 UTSW 4 43,416,508 (GRCm39) missense probably benign 0.05
R8725:Rusc2 UTSW 4 43,401,351 (GRCm39) intron probably benign
R8725:Rusc2 UTSW 4 43,415,396 (GRCm39) missense probably damaging 0.99
R8727:Rusc2 UTSW 4 43,401,351 (GRCm39) intron probably benign
R8834:Rusc2 UTSW 4 43,416,431 (GRCm39) missense possibly damaging 0.94
R9295:Rusc2 UTSW 4 43,416,382 (GRCm39) missense probably damaging 0.98
R9483:Rusc2 UTSW 4 43,415,897 (GRCm39) missense probably damaging 0.97
R9666:Rusc2 UTSW 4 43,416,262 (GRCm39) missense probably benign 0.21
R9705:Rusc2 UTSW 4 43,424,936 (GRCm39) missense probably benign 0.00
X0025:Rusc2 UTSW 4 43,422,226 (GRCm39) missense probably benign 0.00
X0066:Rusc2 UTSW 4 43,422,204 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAAACCCAGAGCTGCTGTTTG -3'
(R):5'- AGTGTTGAGTGCGCAGACAG -3'

Sequencing Primer
(F):5'- ACACTGCAGCAGCCTTTGTG -3'
(R):5'- AGACAGCAGCAGGTCCTG -3'
Posted On 2019-10-24