Incidental Mutation 'R7641:Sorcs2'
ID 590239
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Name sortilin-related VPS10 domain containing receptor 2
Synonyms VPS10 domain receptor protein
MMRRC Submission 045699-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7641 (G1)
Quality Score 192.009
Status Validated
Chromosome 5
Chromosomal Location 36174524-36555483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 36555296 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 32 (R32C)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370] [ENSMUST00000070720]
AlphaFold Q9EPR5
Predicted Effect probably damaging
Transcript: ENSMUST00000037370
AA Change: R32C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: R32C

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000070720
AA Change: R32C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065292
Gene: ENSMUSG00000029093
AA Change: R32C

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
Blast:VPS10 170 213 2e-22 BLAST
low complexity region 214 227 N/A INTRINSIC
Meta Mutation Damage Score 0.1651 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,657,370 (GRCm39) Q641L probably benign Het
Aknad1 A T 3: 108,679,291 (GRCm39) H474L probably benign Het
Alkal1 A T 1: 6,459,712 (GRCm39) Y96F probably damaging Het
Cars1 A G 7: 143,140,840 (GRCm39) probably null Het
Chtf18 A T 17: 25,941,249 (GRCm39) probably null Het
Cog2 C A 8: 125,264,621 (GRCm39) N333K probably damaging Het
Col6a5 T A 9: 105,758,625 (GRCm39) R2194* probably null Het
Dnah14 A T 1: 181,535,098 (GRCm39) I2355L probably benign Het
Dock8 G A 19: 25,151,697 (GRCm39) probably null Het
Dpy19l3 A C 7: 35,394,734 (GRCm39) D601E probably damaging Het
Elf1 G A 14: 79,808,163 (GRCm39) G205E probably damaging Het
Fsip2 A T 2: 82,817,256 (GRCm39) K4330* probably null Het
Gm6525 A T 3: 84,082,150 (GRCm39) T24S probably benign Het
Golga4 G T 9: 118,386,643 (GRCm39) R1255L probably benign Het
Gpn2 A T 4: 133,315,970 (GRCm39) Q243L probably null Het
Grb10 T C 11: 11,883,492 (GRCm39) K588E possibly damaging Het
Gys1 T C 7: 45,104,495 (GRCm39) S641P probably damaging Het
H2-M5 T A 17: 37,298,323 (GRCm39) M331L probably benign Het
Ighv6-6 T A 12: 114,398,837 (GRCm39) I10L probably benign Het
Jmy C T 13: 93,579,107 (GRCm39) R675Q probably damaging Het
Lonp2 A T 8: 87,392,386 (GRCm39) Q484L probably benign Het
Map3k20 T A 2: 72,228,705 (GRCm39) L308H probably damaging Het
Mep1b T C 18: 21,228,034 (GRCm39) F546L possibly damaging Het
Mier1 A G 4: 102,996,637 (GRCm39) E133G possibly damaging Het
Msh3 C A 13: 92,349,011 (GRCm39) V1074L probably benign Het
Muc6 A T 7: 141,224,247 (GRCm39) L1645Q unknown Het
Nat10 G A 2: 103,573,435 (GRCm39) A354V probably damaging Het
Or8b12i A G 9: 20,082,549 (GRCm39) L106P possibly damaging Het
Pdyn A T 2: 129,531,748 (GRCm39) V14E possibly damaging Het
Prdm16 T A 4: 154,429,901 (GRCm39) H356L probably damaging Het
Rasa3 A G 8: 13,634,961 (GRCm39) C453R probably benign Het
Rasgrf2 C T 13: 92,267,914 (GRCm39) S30N possibly damaging Het
Rlf A G 4: 121,016,393 (GRCm39) S315P probably damaging Het
Rusc2 C T 4: 43,425,335 (GRCm39) R1147W possibly damaging Het
Sacs T A 14: 61,440,320 (GRCm39) Y789N probably damaging Het
Sap130 T C 18: 31,786,676 (GRCm39) L289P probably damaging Het
Septin3 A G 15: 82,174,983 (GRCm39) Y308C probably damaging Het
Slc2a12 A G 10: 22,569,893 (GRCm39) D528G probably damaging Het
Slc2a13 A G 15: 91,156,359 (GRCm39) *638Q probably null Het
Smchd1 T A 17: 71,697,474 (GRCm39) E1155D probably benign Het
Sp110 G A 1: 85,506,813 (GRCm39) R417C probably benign Het
Tonsl C T 15: 76,517,852 (GRCm39) D650N probably damaging Het
Tti1 A T 2: 157,850,949 (GRCm39) F97I possibly damaging Het
Ttn T C 2: 76,572,554 (GRCm39) Q26113R possibly damaging Het
Unc5d A T 8: 29,210,003 (GRCm39) N444K probably damaging Het
Usp17la A T 7: 104,510,654 (GRCm39) K420* probably null Het
Vmn2r114 T C 17: 23,527,177 (GRCm39) N452D possibly damaging Het
Vps16 T C 2: 130,282,448 (GRCm39) V427A probably benign Het
Wdr5b T A 16: 35,862,712 (GRCm39) V277D probably damaging Het
Zan T A 5: 137,465,370 (GRCm39) M462L possibly damaging Het
Zfp40 A G 17: 23,397,257 (GRCm39) V80A possibly damaging Het
Zfp930 A T 8: 69,681,337 (GRCm39) H344L probably damaging Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36,194,745 (GRCm39) splice site probably null
IGL01064:Sorcs2 APN 5 36,222,696 (GRCm39) missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36,178,596 (GRCm39) missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36,205,153 (GRCm39) missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36,183,286 (GRCm39) missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36,219,896 (GRCm39) missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36,235,301 (GRCm39) missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36,225,492 (GRCm39) missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36,222,675 (GRCm39) unclassified probably benign
IGL03141:Sorcs2 APN 5 36,222,699 (GRCm39) missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36,188,556 (GRCm39) missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36,203,848 (GRCm39) missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36,311,189 (GRCm39) missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36,554,897 (GRCm39) splice site probably benign
R0345:Sorcs2 UTSW 5 36,185,218 (GRCm39) missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36,188,534 (GRCm39) missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36,222,777 (GRCm39) missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36,181,916 (GRCm39) missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36,185,269 (GRCm39) missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36,184,092 (GRCm39) missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36,386,564 (GRCm39) splice site probably benign
R1935:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36,199,430 (GRCm39) splice site probably null
R3148:Sorcs2 UTSW 5 36,193,132 (GRCm39) missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36,555,150 (GRCm39) missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36,555,007 (GRCm39) nonsense probably null
R4092:Sorcs2 UTSW 5 36,183,166 (GRCm39) missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36,194,838 (GRCm39) missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36,200,796 (GRCm39) missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36,196,734 (GRCm39) missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36,188,527 (GRCm39) missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36,203,874 (GRCm39) nonsense probably null
R5727:Sorcs2 UTSW 5 36,188,630 (GRCm39) missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36,386,555 (GRCm39) missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36,386,535 (GRCm39) missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36,186,427 (GRCm39) missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36,176,728 (GRCm39) missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36,185,332 (GRCm39) splice site probably null
R6290:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36,235,310 (GRCm39) missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36,555,154 (GRCm39) missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36,178,605 (GRCm39) missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36,225,474 (GRCm39) missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36,183,220 (GRCm39) missense probably benign 0.01
R7651:Sorcs2 UTSW 5 36,185,322 (GRCm39) missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36,200,871 (GRCm39) missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36,181,416 (GRCm39) missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36,181,958 (GRCm39) missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36,219,958 (GRCm39) missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36,219,932 (GRCm39) missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36,195,550 (GRCm39) missense probably benign 0.00
R8349:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8350:Sorcs2 UTSW 5 36,311,207 (GRCm39) missense probably damaging 0.96
R8354:Sorcs2 UTSW 5 36,222,753 (GRCm39) missense probably benign 0.01
R8449:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8679:Sorcs2 UTSW 5 36,196,657 (GRCm39) missense probably benign 0.09
R8771:Sorcs2 UTSW 5 36,188,624 (GRCm39) missense probably damaging 1.00
R8935:Sorcs2 UTSW 5 36,193,202 (GRCm39) missense possibly damaging 0.79
R8964:Sorcs2 UTSW 5 36,386,511 (GRCm39) missense possibly damaging 0.85
R9164:Sorcs2 UTSW 5 36,235,312 (GRCm39) missense possibly damaging 0.94
R9221:Sorcs2 UTSW 5 36,181,910 (GRCm39) critical splice donor site probably null
R9290:Sorcs2 UTSW 5 36,183,225 (GRCm39) missense probably damaging 0.96
R9358:Sorcs2 UTSW 5 36,200,814 (GRCm39) missense probably damaging 1.00
R9492:Sorcs2 UTSW 5 36,186,484 (GRCm39) missense probably benign 0.08
R9493:Sorcs2 UTSW 5 36,199,529 (GRCm39) missense possibly damaging 0.61
R9640:Sorcs2 UTSW 5 36,222,765 (GRCm39) nonsense probably null
RF063:Sorcs2 UTSW 5 36,311,155 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATTCTCGTGCCTGTGGATC -3'
(R):5'- GTGACTGCACTCAGGACATC -3'

Sequencing Primer
(F):5'- ATCTTTGCGATCGCCGGAC -3'
(R):5'- CAGAGCTGCGGTGGCTTG -3'
Posted On 2019-10-24