Incidental Mutation 'R7641:Adam1a'
ID590240
Institutional Source Beutler Lab
Gene Symbol Adam1a
Ensembl Gene ENSMUSG00000072647
Gene Namea disintegrin and metallopeptidase domain 1a
Synonymsfertilin alpha, Ftna, PH-30 alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7641 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location121518576-121545482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121519307 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 641 (Q641L)
Ref Sequence ENSEMBL: ENSMUSP00000098320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100757] [ENSMUST00000111795] [ENSMUST00000125946] [ENSMUST00000156080] [ENSMUST00000200170]
Predicted Effect probably benign
Transcript: ENSMUST00000100757
AA Change: Q641L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000098320
Gene: ENSMUSG00000072647
AA Change: Q641L

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 70 191 1.5e-18 PFAM
Pfam:Reprolysin_5 233 410 2.8e-15 PFAM
Pfam:Reprolysin_4 234 421 6.3e-9 PFAM
Pfam:Reprolysin 235 429 1.3e-70 PFAM
Pfam:Reprolysin_3 255 381 3.8e-14 PFAM
Pfam:Reprolysin_2 255 419 5.6e-9 PFAM
DISIN 447 520 6.45e-37 SMART
ACR 521 660 4.59e-62 SMART
EGF 666 697 1.99e1 SMART
transmembrane domain 741 763 N/A INTRINSIC
low complexity region 764 791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111795
SMART Domains Protein: ENSMUSP00000144614
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125946
SMART Domains Protein: ENSMUSP00000142503
Gene: ENSMUSG00000105340

DomainStartEndE-ValueType
S_TKc 22 304 5.3e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156080
SMART Domains Protein: ENSMUSP00000121579
Gene: ENSMUSG00000029452

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 205 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200170
SMART Domains Protein: ENSMUSP00000143668
Gene: ENSMUSG00000072647

DomainStartEndE-ValueType
S_TKc 22 304 8.22e-84 SMART
coiled coil region 407 432 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Homozygous null mice display male infertility with asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aknad1 A T 3: 108,771,975 H474L probably benign Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Cars A G 7: 143,587,103 probably null Het
Chtf18 A T 17: 25,722,275 probably null Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Col6a5 T A 9: 105,881,426 R2194* probably null Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dock8 G A 19: 25,174,333 probably null Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Elf1 G A 14: 79,570,723 G205E probably damaging Het
Fsip2 A T 2: 82,986,912 K4330* probably null Het
Gm6525 A T 3: 84,174,843 T24S probably benign Het
Golga4 G T 9: 118,557,575 R1255L probably benign Het
Gpn2 A T 4: 133,588,659 Q243L probably null Het
Grb10 T C 11: 11,933,492 K588E possibly damaging Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
H2-M5 T A 17: 36,987,431 M331L probably benign Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Map3k20 T A 2: 72,398,361 L308H probably damaging Het
Mep1b T C 18: 21,094,977 F546L possibly damaging Het
Mier1 A G 4: 103,139,440 E133G possibly damaging Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pdyn A T 2: 129,689,828 V14E possibly damaging Het
Prdm16 T A 4: 154,345,444 H356L probably damaging Het
Rasa3 A G 8: 13,584,961 C453R probably benign Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rlf A G 4: 121,159,196 S315P probably damaging Het
Rusc2 C T 4: 43,425,335 R1147W possibly damaging Het
Sacs T A 14: 61,202,871 Y789N probably damaging Het
Sap130 T C 18: 31,653,623 L289P probably damaging Het
Sept3 A G 15: 82,290,782 Y308C probably damaging Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Slc2a13 A G 15: 91,272,156 *638Q probably null Het
Smchd1 T A 17: 71,390,479 E1155D probably benign Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tonsl C T 15: 76,633,652 D650N probably damaging Het
Tti1 A T 2: 158,009,029 F97I possibly damaging Het
Ttn T C 2: 76,742,210 Q26113R possibly damaging Het
Unc5d A T 8: 28,719,975 N444K probably damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r114 T C 17: 23,308,203 N452D possibly damaging Het
Vps16 T C 2: 130,440,528 V427A probably benign Het
Wdr5b T A 16: 36,042,342 V277D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zfp40 A G 17: 23,178,283 V80A possibly damaging Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Adam1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Adam1a APN 5 121519376 missense probably benign 0.09
IGL01467:Adam1a APN 5 121519728 missense probably damaging 1.00
IGL02158:Adam1a APN 5 121518971 nonsense probably null
R1468:Adam1a UTSW 5 121519776 splice site probably null
R1468:Adam1a UTSW 5 121519776 splice site probably null
R1593:Adam1a UTSW 5 121519643 missense probably benign 0.02
R1848:Adam1a UTSW 5 121519620 missense probably damaging 1.00
R1925:Adam1a UTSW 5 121519450 nonsense probably null
R2176:Adam1a UTSW 5 121519586 missense probably benign 0.01
R2232:Adam1a UTSW 5 121519732 missense possibly damaging 0.93
R3692:Adam1a UTSW 5 121519322 missense probably damaging 1.00
R4732:Adam1a UTSW 5 121519434 missense probably benign 0.34
R4733:Adam1a UTSW 5 121519434 missense probably benign 0.34
R4835:Adam1a UTSW 5 121519689 missense probably damaging 1.00
R5199:Adam1a UTSW 5 121521152 missense probably benign 0.23
R6026:Adam1a UTSW 5 121519362 missense probably damaging 1.00
R6936:Adam1a UTSW 5 121519362 missense probably damaging 1.00
R7016:Adam1a UTSW 5 121521038 missense probably benign 0.01
R7124:Adam1a UTSW 5 121519334 missense probably benign 0.15
R7294:Adam1a UTSW 5 121520005 nonsense probably null
R7501:Adam1a UTSW 5 121518948 missense possibly damaging 0.85
R8548:Adam1a UTSW 5 121520102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAAGTGTCGATCAGCGG -3'
(R):5'- CAGATATGAAACATGTTCCGATGAG -3'

Sequencing Primer
(F):5'- AAGTGTCGATCAGCGGGCTTAC -3'
(R):5'- CGATGAGGATGTATTTTGTGGGAAAC -3'
Posted On2019-10-24