Incidental Mutation 'R7641:Usp17la'
ID590244
Institutional Source Beutler Lab
Gene Symbol Usp17la
Ensembl Gene ENSMUSG00000054568
Gene Nameubiquitin specific peptidase 17-like A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7641 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104857009-104862667 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 104861447 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 420 (K420*)
Ref Sequence ENSEMBL: ENSMUSP00000068997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067695]
Predicted Effect probably null
Transcript: ENSMUST00000067695
AA Change: K420*
SMART Domains Protein: ENSMUSP00000068997
Gene: ENSMUSG00000054568
AA Change: K420*

DomainStartEndE-ValueType
Pfam:UCH 50 345 3.3e-53 PFAM
Pfam:UCH_1 51 328 1.1e-24 PFAM
low complexity region 374 385 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,519,307 Q641L probably benign Het
Aknad1 A T 3: 108,771,975 H474L probably benign Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Cars A G 7: 143,587,103 probably null Het
Chtf18 A T 17: 25,722,275 probably null Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Col6a5 T A 9: 105,881,426 R2194* probably null Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dock8 G A 19: 25,174,333 probably null Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Elf1 G A 14: 79,570,723 G205E probably damaging Het
Fsip2 A T 2: 82,986,912 K4330* probably null Het
Gm6525 A T 3: 84,174,843 T24S probably benign Het
Golga4 G T 9: 118,557,575 R1255L probably benign Het
Gpn2 A T 4: 133,588,659 Q243L probably null Het
Grb10 T C 11: 11,933,492 K588E possibly damaging Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
H2-M5 T A 17: 36,987,431 M331L probably benign Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Map3k20 T A 2: 72,398,361 L308H probably damaging Het
Mep1b T C 18: 21,094,977 F546L possibly damaging Het
Mier1 A G 4: 103,139,440 E133G possibly damaging Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pdyn A T 2: 129,689,828 V14E possibly damaging Het
Prdm16 T A 4: 154,345,444 H356L probably damaging Het
Rasa3 A G 8: 13,584,961 C453R probably benign Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rlf A G 4: 121,159,196 S315P probably damaging Het
Rusc2 C T 4: 43,425,335 R1147W possibly damaging Het
Sacs T A 14: 61,202,871 Y789N probably damaging Het
Sap130 T C 18: 31,653,623 L289P probably damaging Het
Sept3 A G 15: 82,290,782 Y308C probably damaging Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Slc2a13 A G 15: 91,272,156 *638Q probably null Het
Smchd1 T A 17: 71,390,479 E1155D probably benign Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tonsl C T 15: 76,633,652 D650N probably damaging Het
Tti1 A T 2: 158,009,029 F97I possibly damaging Het
Ttn T C 2: 76,742,210 Q26113R possibly damaging Het
Unc5d A T 8: 28,719,975 N444K probably damaging Het
Vmn2r114 T C 17: 23,308,203 N452D possibly damaging Het
Vps16 T C 2: 130,440,528 V427A probably benign Het
Wdr5b T A 16: 36,042,342 V277D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zfp40 A G 17: 23,178,283 V80A possibly damaging Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Usp17la
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Usp17la APN 7 104861315 missense probably benign 0.04
IGL01482:Usp17la APN 7 104859393 start codon destroyed probably benign 0.28
IGL02236:Usp17la APN 7 104861146 nonsense probably null
IGL03239:Usp17la APN 7 104860620 missense possibly damaging 0.69
R0512:Usp17la UTSW 7 104861039 missense possibly damaging 0.50
R1632:Usp17la UTSW 7 104860911 missense probably benign 0.02
R1828:Usp17la UTSW 7 104861124 missense probably damaging 1.00
R1918:Usp17la UTSW 7 104860746 missense probably benign 0.11
R1976:Usp17la UTSW 7 104860320 missense possibly damaging 0.81
R2058:Usp17la UTSW 7 104861171 missense probably damaging 1.00
R2059:Usp17la UTSW 7 104861171 missense probably damaging 1.00
R2078:Usp17la UTSW 7 104859393 start codon destroyed probably benign 0.28
R2197:Usp17la UTSW 7 104860712 missense probably damaging 1.00
R3610:Usp17la UTSW 7 104861072 missense probably damaging 1.00
R3684:Usp17la UTSW 7 104861730 missense possibly damaging 0.96
R4480:Usp17la UTSW 7 104860690 missense probably benign 0.15
R4633:Usp17la UTSW 7 104860221 missense possibly damaging 0.92
R4701:Usp17la UTSW 7 104860649 nonsense probably null
R4907:Usp17la UTSW 7 104861148 missense probably damaging 1.00
R5057:Usp17la UTSW 7 104861123 missense possibly damaging 0.95
R5091:Usp17la UTSW 7 104860932 missense probably damaging 0.99
R5313:Usp17la UTSW 7 104861250 missense probably benign 0.00
R6269:Usp17la UTSW 7 104860350 missense possibly damaging 0.82
R7054:Usp17la UTSW 7 104861307 missense probably benign 0.38
R7395:Usp17la UTSW 7 104861585 missense probably benign 0.30
R7570:Usp17la UTSW 7 104860397 missense probably damaging 1.00
R7633:Usp17la UTSW 7 104861147 missense probably damaging 1.00
R7674:Usp17la UTSW 7 104861447 nonsense probably null
X0062:Usp17la UTSW 7 104861478 missense probably damaging 0.99
Z1177:Usp17la UTSW 7 104861026 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCTATGTGCAGCAGGCCAAC -3'
(R):5'- CTTGTCTGGAGAATCCCTGC -3'

Sequencing Primer
(F):5'- TCAGTATTGACATGCCAGAGG -3'
(R):5'- GAGAATCCCTGCCCCAGTTTG -3'
Posted On2019-10-24