Incidental Mutation 'R7641:Cars'
ID590246
Institutional Source Beutler Lab
Gene Symbol Cars
Ensembl Gene ENSMUSG00000010755
Gene Namecysteinyl-tRNA synthetase
SynonymsCA3
MMRRC Submission
Accession Numbers

Genbank: NM_013742

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7641 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location143557230-143600090 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 143587103 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000010899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010899] [ENSMUST00000105909] [ENSMUST00000154022]
Predicted Effect probably null
Transcript: ENSMUST00000010899
SMART Domains Protein: ENSMUSP00000010899
Gene: ENSMUSG00000010755

DomainStartEndE-ValueType
Pfam:tRNA-synt_1e 124 537 2.7e-128 PFAM
Blast:DALR_2 584 644 2e-13 BLAST
coiled coil region 728 768 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105909
SMART Domains Protein: ENSMUSP00000101529
Gene: ENSMUSG00000010755

DomainStartEndE-ValueType
Pfam:tRNA-synt_1e 41 454 2e-129 PFAM
Pfam:tRNA-synt_1g 387 465 1.2e-6 PFAM
Blast:DALR_2 501 561 1e-13 BLAST
coiled coil region 645 685 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154022
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, cysteinyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. This gene is one of several located near the imprinted gene domain on chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2010]
Allele List at MGI

All alleles(37) : Targeted, other(2) Gene trapped(35)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,519,307 Q641L probably benign Het
Aknad1 A T 3: 108,771,975 H474L probably benign Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Chtf18 A T 17: 25,722,275 probably null Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Col6a5 T A 9: 105,881,426 R2194* probably null Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dock8 G A 19: 25,174,333 probably null Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Elf1 G A 14: 79,570,723 G205E probably damaging Het
Fsip2 A T 2: 82,986,912 K4330* probably null Het
Gm6525 A T 3: 84,174,843 T24S probably benign Het
Golga4 G T 9: 118,557,575 R1255L probably benign Het
Gpn2 A T 4: 133,588,659 Q243L probably null Het
Grb10 T C 11: 11,933,492 K588E possibly damaging Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
H2-M5 T A 17: 36,987,431 M331L probably benign Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Map3k20 T A 2: 72,398,361 L308H probably damaging Het
Mep1b T C 18: 21,094,977 F546L possibly damaging Het
Mier1 A G 4: 103,139,440 E133G possibly damaging Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pdyn A T 2: 129,689,828 V14E possibly damaging Het
Prdm16 T A 4: 154,345,444 H356L probably damaging Het
Rasa3 A G 8: 13,584,961 C453R probably benign Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rlf A G 4: 121,159,196 S315P probably damaging Het
Rusc2 C T 4: 43,425,335 R1147W possibly damaging Het
Sacs T A 14: 61,202,871 Y789N probably damaging Het
Sap130 T C 18: 31,653,623 L289P probably damaging Het
Sept3 A G 15: 82,290,782 Y308C probably damaging Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Slc2a13 A G 15: 91,272,156 *638Q probably null Het
Smchd1 T A 17: 71,390,479 E1155D probably benign Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tonsl C T 15: 76,633,652 D650N probably damaging Het
Tti1 A T 2: 158,009,029 F97I possibly damaging Het
Ttn T C 2: 76,742,210 Q26113R possibly damaging Het
Unc5d A T 8: 28,719,975 N444K probably damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r114 T C 17: 23,308,203 N452D possibly damaging Het
Vps16 T C 2: 130,440,528 V427A probably benign Het
Wdr5b T A 16: 36,042,342 V277D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zfp40 A G 17: 23,178,283 V80A possibly damaging Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Cars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Cars APN 7 143569849 missense probably benign 0.03
IGL02192:Cars APN 7 143571588 missense probably damaging 1.00
IGL02645:Cars APN 7 143557909 missense probably damaging 0.97
IGL02807:Cars APN 7 143569472 missense possibly damaging 0.87
IGL02860:Cars APN 7 143586421 missense probably damaging 1.00
IGL03005:Cars APN 7 143559169 missense probably damaging 1.00
vroom UTSW 7 143570648 missense probably damaging 1.00
F5493:Cars UTSW 7 143569871 missense probably damaging 1.00
R0358:Cars UTSW 7 143588482 splice site probably benign
R0452:Cars UTSW 7 143592625 nonsense probably null
R0717:Cars UTSW 7 143584755 missense probably damaging 0.98
R0930:Cars UTSW 7 143570570 missense probably damaging 1.00
R1069:Cars UTSW 7 143570107 missense probably benign 0.40
R1184:Cars UTSW 7 143587139 missense probably damaging 1.00
R1503:Cars UTSW 7 143568989 missense probably benign 0.04
R1755:Cars UTSW 7 143569457 missense probably damaging 1.00
R1762:Cars UTSW 7 143592474 missense probably damaging 1.00
R1783:Cars UTSW 7 143592474 missense probably damaging 1.00
R1786:Cars UTSW 7 143592474 missense probably damaging 1.00
R1828:Cars UTSW 7 143576648 missense probably damaging 0.97
R2084:Cars UTSW 7 143587182 missense probably benign 0.03
R2132:Cars UTSW 7 143592474 missense probably damaging 1.00
R2133:Cars UTSW 7 143592474 missense probably damaging 1.00
R2397:Cars UTSW 7 143592507 missense possibly damaging 0.61
R4012:Cars UTSW 7 143559674 missense possibly damaging 0.65
R4057:Cars UTSW 7 143570648 missense probably damaging 1.00
R4082:Cars UTSW 7 143569497 missense probably damaging 1.00
R4118:Cars UTSW 7 143559647 critical splice donor site probably null
R4527:Cars UTSW 7 143565049 missense probably benign 0.22
R4663:Cars UTSW 7 143575960 missense probably damaging 1.00
R4758:Cars UTSW 7 143571567 missense probably benign 0.01
R4820:Cars UTSW 7 143570564 missense probably damaging 1.00
R4921:Cars UTSW 7 143569475 missense probably damaging 1.00
R4923:Cars UTSW 7 143569850 missense probably damaging 0.97
R5512:Cars UTSW 7 143570133 missense possibly damaging 0.91
R6505:Cars UTSW 7 143565007 missense probably damaging 1.00
R7125:Cars UTSW 7 143584773 missense probably benign 0.01
R7674:Cars UTSW 7 143587103 critical splice donor site probably null
R7812:Cars UTSW 7 143570047 missense probably damaging 1.00
X0021:Cars UTSW 7 143576584 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGAAATTCAGCGTGTTAGGGAC -3'
(R):5'- AGTGTGCTGTCTATGGCTCC -3'

Sequencing Primer
(F):5'- AAAAGTCACACCGTTAACGTGTG -3'
(R):5'- ATGGCTCCTCTTGCTGTGCTG -3'
Posted On2019-10-24