Incidental Mutation 'R7641:Rasa3'
ID590247
Institutional Source Beutler Lab
Gene Symbol Rasa3
Ensembl Gene ENSMUSG00000031453
Gene NameRAS p21 protein activator 3
SynonymsGAPIII, R-Ras gap, Ras GTPase-activating protein III, GAPIII activator 3, scat
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7641 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13566948-13677603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13584961 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 453 (C453R)
Ref Sequence ENSEMBL: ENSMUSP00000112998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117551]
Predicted Effect probably benign
Transcript: ENSMUST00000117551
AA Change: C453R

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112998
Gene: ENSMUSG00000031453
AA Change: C453R

DomainStartEndE-ValueType
C2 13 111 2.29e-15 SMART
C2 146 262 1.03e-17 SMART
RasGAP 275 614 3.96e-166 SMART
PH 577 679 5.53e-16 SMART
BTK 679 715 9.16e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds inositol 1,3,4,5-tetrakisphosphate and stimulates the GTPase activity of Ras p21. This protein functions as a negative regulator of the Ras signalling pathway. It is localized to the cell membrane via a pleckstrin homology (PH) domain in the C-terminal region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation die at E12.5-13.5 of massive subcutaneous and intraparenchymal hemorrhage, probably due to underdeveloped adherens junctions between capillary endothelial cells. At E12.5, edema and severe hemorrhaging is frequently observed in the brain and/or rump. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,519,307 Q641L probably benign Het
Aknad1 A T 3: 108,771,975 H474L probably benign Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Cars A G 7: 143,587,103 probably null Het
Chtf18 A T 17: 25,722,275 probably null Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Col6a5 T A 9: 105,881,426 R2194* probably null Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dock8 G A 19: 25,174,333 probably null Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Elf1 G A 14: 79,570,723 G205E probably damaging Het
Fsip2 A T 2: 82,986,912 K4330* probably null Het
Gm6525 A T 3: 84,174,843 T24S probably benign Het
Golga4 G T 9: 118,557,575 R1255L probably benign Het
Gpn2 A T 4: 133,588,659 Q243L probably null Het
Grb10 T C 11: 11,933,492 K588E possibly damaging Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
H2-M5 T A 17: 36,987,431 M331L probably benign Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Map3k20 T A 2: 72,398,361 L308H probably damaging Het
Mep1b T C 18: 21,094,977 F546L possibly damaging Het
Mier1 A G 4: 103,139,440 E133G possibly damaging Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pdyn A T 2: 129,689,828 V14E possibly damaging Het
Prdm16 T A 4: 154,345,444 H356L probably damaging Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rlf A G 4: 121,159,196 S315P probably damaging Het
Rusc2 C T 4: 43,425,335 R1147W possibly damaging Het
Sacs T A 14: 61,202,871 Y789N probably damaging Het
Sap130 T C 18: 31,653,623 L289P probably damaging Het
Sept3 A G 15: 82,290,782 Y308C probably damaging Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Slc2a13 A G 15: 91,272,156 *638Q probably null Het
Smchd1 T A 17: 71,390,479 E1155D probably benign Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tonsl C T 15: 76,633,652 D650N probably damaging Het
Tti1 A T 2: 158,009,029 F97I possibly damaging Het
Ttn T C 2: 76,742,210 Q26113R possibly damaging Het
Unc5d A T 8: 28,719,975 N444K probably damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r114 T C 17: 23,308,203 N452D possibly damaging Het
Vps16 T C 2: 130,440,528 V427A probably benign Het
Wdr5b T A 16: 36,042,342 V277D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zfp40 A G 17: 23,178,283 V80A possibly damaging Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Rasa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Rasa3 APN 8 13595410 unclassified probably benign
IGL02112:Rasa3 APN 8 13585042 splice site probably benign
IGL02946:Rasa3 APN 8 13598280 missense probably benign 0.33
IGL03085:Rasa3 APN 8 13585690 missense probably benign 0.11
Box_canyon UTSW 8 13584959 nonsense probably null
koko_head UTSW 8 13614605 missense possibly damaging 0.70
Mount_ouray UTSW 8 13631811 missense possibly damaging 0.90
Poncha_pass UTSW 8 13595373 missense possibly damaging 0.46
Ute UTSW 8 13582381 splice site probably benign
PIT4531001:Rasa3 UTSW 8 13605887 missense probably benign 0.11
R0193:Rasa3 UTSW 8 13570233 splice site probably null
R0710:Rasa3 UTSW 8 13583830 missense probably damaging 1.00
R0726:Rasa3 UTSW 8 13580118 splice site probably benign
R1405:Rasa3 UTSW 8 13588027 missense possibly damaging 0.83
R1405:Rasa3 UTSW 8 13588027 missense possibly damaging 0.83
R1797:Rasa3 UTSW 8 13582372 missense probably benign 0.44
R1828:Rasa3 UTSW 8 13585035 missense probably benign 0.02
R1895:Rasa3 UTSW 8 13631768 splice site probably benign
R2090:Rasa3 UTSW 8 13582381 splice site probably benign
R2374:Rasa3 UTSW 8 13577411 missense probably damaging 1.00
R2655:Rasa3 UTSW 8 13595373 missense possibly damaging 0.46
R3703:Rasa3 UTSW 8 13588972 missense probably benign
R3899:Rasa3 UTSW 8 13578635 missense probably benign 0.21
R4230:Rasa3 UTSW 8 13570264 missense possibly damaging 0.47
R4256:Rasa3 UTSW 8 13614532 critical splice donor site probably null
R4281:Rasa3 UTSW 8 13588946 missense probably benign 0.01
R4498:Rasa3 UTSW 8 13614587 missense probably benign 0.01
R4558:Rasa3 UTSW 8 13598259 missense probably damaging 0.96
R4559:Rasa3 UTSW 8 13598259 missense probably damaging 0.96
R4647:Rasa3 UTSW 8 13588865 missense probably null 0.00
R4702:Rasa3 UTSW 8 13570394 missense probably benign 0.09
R4772:Rasa3 UTSW 8 13598289 missense probably damaging 1.00
R4774:Rasa3 UTSW 8 13577501 missense probably benign 0.07
R4807:Rasa3 UTSW 8 13614633 missense probably damaging 1.00
R5008:Rasa3 UTSW 8 13584959 nonsense probably null
R5043:Rasa3 UTSW 8 13570368 missense possibly damaging 0.59
R5352:Rasa3 UTSW 8 13631778 missense possibly damaging 0.88
R5435:Rasa3 UTSW 8 13631811 missense possibly damaging 0.90
R6207:Rasa3 UTSW 8 13598251 missense possibly damaging 0.67
R6733:Rasa3 UTSW 8 13580037 missense possibly damaging 0.88
R6855:Rasa3 UTSW 8 13585029 missense probably damaging 1.00
R7024:Rasa3 UTSW 8 13631826 missense probably benign 0.29
R7100:Rasa3 UTSW 8 13586897 missense probably benign 0.02
R7322:Rasa3 UTSW 8 13595857 missense possibly damaging 0.46
R7394:Rasa3 UTSW 8 13595353 missense probably benign 0.03
R7478:Rasa3 UTSW 8 13614605 missense possibly damaging 0.70
R7486:Rasa3 UTSW 8 13590201 critical splice donor site probably null
R7554:Rasa3 UTSW 8 13595390 missense probably damaging 0.99
R7575:Rasa3 UTSW 8 13595887 missense possibly damaging 0.73
R7667:Rasa3 UTSW 8 13588015 missense probably benign 0.27
R7751:Rasa3 UTSW 8 13568708 missense probably benign 0.18
R7999:Rasa3 UTSW 8 13631805 missense probably benign 0.04
R8039:Rasa3 UTSW 8 13588931 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTTCTTAGCAAGGCAGTAAC -3'
(R):5'- TTTGCAAGCATCATGGAGGG -3'

Sequencing Primer
(F):5'- GGCAGTAACTTAGAATTCATGACCC -3'
(R):5'- ATCATGGAGGGCTGGGCTC -3'
Posted On2019-10-24