Mutagenetix > Incidental Mutation

Incidental Mutation 'R7641:Cog2'

590251

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

045699-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7641 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 124537882 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 333 (N333K)

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460]

AlphaFold

Q921L5

Predicted Effect

probably damaging
Transcript: ENSMUST00000034460
AA Change: N333K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: N333K

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam1a	T	A	5: 121,519,307	Q641L	probably benign	Het
Aknad1	A	T	3: 108,771,975	H474L	probably benign	Het
Alkal1	A	T	1: 6,389,488	Y96F	probably damaging	Het
Cars	A	G	7: 143,587,103		probably null	Het
Chtf18	A	T	17: 25,722,275		probably null	Het
Col6a5	T	A	9: 105,881,426	R2194*	probably null	Het
Dnah14	A	T	1: 181,707,533	I2355L	probably benign	Het
Dock8	G	A	19: 25,174,333		probably null	Het
Dpy19l3	A	C	7: 35,695,309	D601E	probably damaging	Het
Elf1	G	A	14: 79,570,723	G205E	probably damaging	Het
Fsip2	A	T	2: 82,986,912	K4330*	probably null	Het
Gm6525	A	T	3: 84,174,843	T24S	probably benign	Het
Golga4	G	T	9: 118,557,575	R1255L	probably benign	Het
Gpn2	A	T	4: 133,588,659	Q243L	probably null	Het
Grb10	T	C	11: 11,933,492	K588E	possibly damaging	Het
Gys1	T	C	7: 45,455,071	S641P	probably damaging	Het
H2-M5	T	A	17: 36,987,431	M331L	probably benign	Het
Ighv6-6	T	A	12: 114,435,217	I10L	probably benign	Het
Jmy	C	T	13: 93,442,599	R675Q	probably damaging	Het
Lonp2	A	T	8: 86,665,758	Q484L	probably benign	Het
Map3k20	T	A	2: 72,398,361	L308H	probably damaging	Het
Mep1b	T	C	18: 21,094,977	F546L	possibly damaging	Het
Mier1	A	G	4: 103,139,440	E133G	possibly damaging	Het
Msh3	C	A	13: 92,212,503	V1074L	probably benign	Het
Muc6	A	T	7: 141,639,825	L1645Q	unknown	Het
Nat10	G	A	2: 103,743,090	A354V	probably damaging	Het
Olfr870	A	G	9: 20,171,253	L106P	possibly damaging	Het
Pdyn	A	T	2: 129,689,828	V14E	possibly damaging	Het
Prdm16	T	A	4: 154,345,444	H356L	probably damaging	Het
Rasa3	A	G	8: 13,584,961	C453R	probably benign	Het
Rasgrf2	C	T	13: 92,131,406	S30N	possibly damaging	Het
Rlf	A	G	4: 121,159,196	S315P	probably damaging	Het
Rusc2	C	T	4: 43,425,335	R1147W	possibly damaging	Het
Sacs	T	A	14: 61,202,871	Y789N	probably damaging	Het
Sap130	T	C	18: 31,653,623	L289P	probably damaging	Het
Sept3	A	G	15: 82,290,782	Y308C	probably damaging	Het
Slc2a12	A	G	10: 22,693,994	D528G	probably damaging	Het
Slc2a13	A	G	15: 91,272,156	*638Q	probably null	Het
Smchd1	T	A	17: 71,390,479	E1155D	probably benign	Het
Sorcs2	G	A	5: 36,397,952	R32C	probably damaging	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Tonsl	C	T	15: 76,633,652	D650N	probably damaging	Het
Tti1	A	T	2: 158,009,029	F97I	possibly damaging	Het
Ttn	T	C	2: 76,742,210	Q26113R	possibly damaging	Het
Unc5d	A	T	8: 28,719,975	N444K	probably damaging	Het
Usp17la	A	T	7: 104,861,447	K420*	probably null	Het
Vmn2r114	T	C	17: 23,308,203	N452D	possibly damaging	Het
Vps16	T	C	2: 130,440,528	V427A	probably benign	Het
Wdr5b	T	A	16: 36,042,342	V277D	probably damaging	Het
Zan	T	A	5: 137,467,108	M462L	possibly damaging	Het
Zfp40	A	G	17: 23,178,283	V80A	possibly damaging	Het
Zfp930	A	T	8: 69,228,685	H344L	probably damaging	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AGCGAAGAGTTCCACAACTGG -3'
(R):5'- TCCAAGTATCATATCCACACTTGAG -3'

Sequencing Primer
(F):5'- GAAGAGTTCCACAACTGGTTCCTG -3'
(R):5'- GTATCATATCCACACTTGAGAGAAGC -3'

Posted On

2019-10-24