Incidental Mutation 'R7641:Cog2'
ID590251
Institutional Source Beutler Lab
Gene Symbol Cog2
Ensembl Gene ENSMUSG00000031979
Gene Namecomponent of oligomeric golgi complex 2
Synonyms2700012E02Rik, 1190002B08Rik, Cog2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7641 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124520767-124552008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 124537882 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 333 (N333K)
Ref Sequence ENSEMBL: ENSMUSP00000034460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034460]
Predicted Effect probably damaging
Transcript: ENSMUST00000034460
AA Change: N333K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: N333K

DomainStartEndE-ValueType
Pfam:COG2 15 147 1.4e-44 PFAM
low complexity region 207 220 N/A INTRINSIC
low complexity region 490 502 N/A INTRINSIC
Pfam:DUF3510 565 692 6.1e-45 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,519,307 Q641L probably benign Het
Aknad1 A T 3: 108,771,975 H474L probably benign Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Cars A G 7: 143,587,103 probably null Het
Chtf18 A T 17: 25,722,275 probably null Het
Col6a5 T A 9: 105,881,426 R2194* probably null Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dock8 G A 19: 25,174,333 probably null Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Elf1 G A 14: 79,570,723 G205E probably damaging Het
Fsip2 A T 2: 82,986,912 K4330* probably null Het
Gm6525 A T 3: 84,174,843 T24S probably benign Het
Golga4 G T 9: 118,557,575 R1255L probably benign Het
Gpn2 A T 4: 133,588,659 Q243L probably null Het
Grb10 T C 11: 11,933,492 K588E possibly damaging Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
H2-M5 T A 17: 36,987,431 M331L probably benign Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Map3k20 T A 2: 72,398,361 L308H probably damaging Het
Mep1b T C 18: 21,094,977 F546L possibly damaging Het
Mier1 A G 4: 103,139,440 E133G possibly damaging Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pdyn A T 2: 129,689,828 V14E possibly damaging Het
Prdm16 T A 4: 154,345,444 H356L probably damaging Het
Rasa3 A G 8: 13,584,961 C453R probably benign Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rlf A G 4: 121,159,196 S315P probably damaging Het
Rusc2 C T 4: 43,425,335 R1147W possibly damaging Het
Sacs T A 14: 61,202,871 Y789N probably damaging Het
Sap130 T C 18: 31,653,623 L289P probably damaging Het
Sept3 A G 15: 82,290,782 Y308C probably damaging Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Slc2a13 A G 15: 91,272,156 *638Q probably null Het
Smchd1 T A 17: 71,390,479 E1155D probably benign Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tonsl C T 15: 76,633,652 D650N probably damaging Het
Tti1 A T 2: 158,009,029 F97I possibly damaging Het
Ttn T C 2: 76,742,210 Q26113R possibly damaging Het
Unc5d A T 8: 28,719,975 N444K probably damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r114 T C 17: 23,308,203 N452D possibly damaging Het
Vps16 T C 2: 130,440,528 V427A probably benign Het
Wdr5b T A 16: 36,042,342 V277D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zfp40 A G 17: 23,178,283 V80A possibly damaging Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Cog2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Cog2 APN 8 124545243 missense probably benign 0.00
IGL01092:Cog2 APN 8 124545280 missense probably damaging 1.00
IGL01150:Cog2 APN 8 124542891 missense possibly damaging 0.62
IGL02052:Cog2 APN 8 124542888 critical splice acceptor site probably null
IGL02308:Cog2 APN 8 124533212 critical splice acceptor site probably null
IGL02543:Cog2 APN 8 124529959 missense probably benign 0.09
IGL02978:Cog2 APN 8 124550336 missense probably benign
IGL03008:Cog2 APN 8 124535392 splice site probably benign
IGL03144:Cog2 APN 8 124541024 missense probably damaging 0.98
kugge UTSW 8 124550232 missense probably damaging 1.00
Pelota UTSW 8 124550306 missense probably damaging 1.00
PIT4677001:Cog2 UTSW 8 124545271 missense probably benign 0.22
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0071:Cog2 UTSW 8 124548668 splice site probably benign
R0110:Cog2 UTSW 8 124529058 critical splice donor site probably null
R0436:Cog2 UTSW 8 124548514 splice site probably benign
R0450:Cog2 UTSW 8 124529058 critical splice donor site probably null
R1365:Cog2 UTSW 8 124540974 missense probably damaging 0.97
R1661:Cog2 UTSW 8 124542890 missense probably benign 0.20
R1698:Cog2 UTSW 8 124525683 missense probably damaging 1.00
R1856:Cog2 UTSW 8 124551403 missense possibly damaging 0.93
R2122:Cog2 UTSW 8 124528985 missense possibly damaging 0.91
R2398:Cog2 UTSW 8 124529926 missense probably benign 0.07
R3855:Cog2 UTSW 8 124530003 critical splice donor site probably null
R4580:Cog2 UTSW 8 124545136 missense probably benign 0.01
R4803:Cog2 UTSW 8 124535451 missense probably damaging 0.96
R5316:Cog2 UTSW 8 124529040 missense probably benign 0.14
R5346:Cog2 UTSW 8 124546631 missense possibly damaging 0.94
R5394:Cog2 UTSW 8 124532529 missense probably benign 0.00
R5395:Cog2 UTSW 8 124545221 missense probably benign 0.00
R5738:Cog2 UTSW 8 124546038 missense probably benign 0.03
R5861:Cog2 UTSW 8 124537878 missense probably damaging 1.00
R5894:Cog2 UTSW 8 124545267 missense probably benign 0.00
R5941:Cog2 UTSW 8 124546086 missense probably benign
R6186:Cog2 UTSW 8 124546686 missense probably damaging 1.00
R6400:Cog2 UTSW 8 124550306 missense probably damaging 1.00
R6518:Cog2 UTSW 8 124527103 nonsense probably null
R6558:Cog2 UTSW 8 124550232 missense probably damaging 1.00
R6717:Cog2 UTSW 8 124525749 missense probably damaging 1.00
R6902:Cog2 UTSW 8 124546691 missense probably damaging 1.00
R6914:Cog2 UTSW 8 124545136 missense probably benign 0.00
R6942:Cog2 UTSW 8 124545136 missense probably benign 0.00
R7103:Cog2 UTSW 8 124541114 critical splice donor site probably null
R7274:Cog2 UTSW 8 124535519 missense possibly damaging 0.71
R7674:Cog2 UTSW 8 124537882 missense probably damaging 0.96
R8559:Cog2 UTSW 8 124542908 missense probably benign 0.25
X0026:Cog2 UTSW 8 124546020 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCGAAGAGTTCCACAACTGG -3'
(R):5'- TCCAAGTATCATATCCACACTTGAG -3'

Sequencing Primer
(F):5'- GAAGAGTTCCACAACTGGTTCCTG -3'
(R):5'- GTATCATATCCACACTTGAGAGAAGC -3'
Posted On2019-10-24