Incidental Mutation 'R7641:Olfr870'
ID590252
Institutional Source Beutler Lab
Gene Symbol Olfr870
Ensembl Gene ENSMUSG00000066899
Gene Nameolfactory receptor 870
SynonymsGA_x6K02T2PVTD-13912679-13911744, MOR141-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7641 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20168533-20174057 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20171253 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 106 (L106P)
Ref Sequence ENSEMBL: ENSMUSP00000150084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086476] [ENSMUST00000215984]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086476
AA Change: L106P

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091405
Gene: ENSMUSG00000066899
AA Change: L106P

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 1.8e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.8e-7 PFAM
Pfam:7tm_1 41 290 3.9e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215984
AA Change: L106P

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,519,307 Q641L probably benign Het
Aknad1 A T 3: 108,771,975 H474L probably benign Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Cars A G 7: 143,587,103 probably null Het
Chtf18 A T 17: 25,722,275 probably null Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Col6a5 T A 9: 105,881,426 R2194* probably null Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dock8 G A 19: 25,174,333 probably null Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Elf1 G A 14: 79,570,723 G205E probably damaging Het
Fsip2 A T 2: 82,986,912 K4330* probably null Het
Gm6525 A T 3: 84,174,843 T24S probably benign Het
Golga4 G T 9: 118,557,575 R1255L probably benign Het
Gpn2 A T 4: 133,588,659 Q243L probably null Het
Grb10 T C 11: 11,933,492 K588E possibly damaging Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
H2-M5 T A 17: 36,987,431 M331L probably benign Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Map3k20 T A 2: 72,398,361 L308H probably damaging Het
Mep1b T C 18: 21,094,977 F546L possibly damaging Het
Mier1 A G 4: 103,139,440 E133G possibly damaging Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Pdyn A T 2: 129,689,828 V14E possibly damaging Het
Prdm16 T A 4: 154,345,444 H356L probably damaging Het
Rasa3 A G 8: 13,584,961 C453R probably benign Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rlf A G 4: 121,159,196 S315P probably damaging Het
Rusc2 C T 4: 43,425,335 R1147W possibly damaging Het
Sacs T A 14: 61,202,871 Y789N probably damaging Het
Sap130 T C 18: 31,653,623 L289P probably damaging Het
Sept3 A G 15: 82,290,782 Y308C probably damaging Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Slc2a13 A G 15: 91,272,156 *638Q probably null Het
Smchd1 T A 17: 71,390,479 E1155D probably benign Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tonsl C T 15: 76,633,652 D650N probably damaging Het
Tti1 A T 2: 158,009,029 F97I possibly damaging Het
Ttn T C 2: 76,742,210 Q26113R possibly damaging Het
Unc5d A T 8: 28,719,975 N444K probably damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r114 T C 17: 23,308,203 N452D possibly damaging Het
Vps16 T C 2: 130,440,528 V427A probably benign Het
Wdr5b T A 16: 36,042,342 V277D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zfp40 A G 17: 23,178,283 V80A possibly damaging Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Olfr870
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr870 APN 9 20171530 missense probably damaging 1.00
IGL01809:Olfr870 APN 9 20171295 missense probably damaging 1.00
IGL02130:Olfr870 APN 9 20171358 missense probably damaging 0.96
IGL03062:Olfr870 APN 9 20171167 missense probably damaging 1.00
IGL03133:Olfr870 APN 9 20170713 missense probably damaging 1.00
R0110:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R0350:Olfr870 UTSW 9 20170736 nonsense probably null
R0417:Olfr870 UTSW 9 20171214 missense probably damaging 1.00
R0450:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R0469:Olfr870 UTSW 9 20171265 missense probably benign 0.04
R1169:Olfr870 UTSW 9 20171058 missense probably benign 0.04
R1728:Olfr870 UTSW 9 20170913 nonsense probably null
R1729:Olfr870 UTSW 9 20170913 nonsense probably null
R1776:Olfr870 UTSW 9 20170809 missense probably benign 0.16
R1784:Olfr870 UTSW 9 20170913 nonsense probably null
R1914:Olfr870 UTSW 9 20171028 missense probably benign 0.22
R1915:Olfr870 UTSW 9 20171028 missense probably benign 0.22
R1929:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R1936:Olfr870 UTSW 9 20171181 missense probably damaging 1.00
R2066:Olfr870 UTSW 9 20171554 missense probably benign 0.01
R2137:Olfr870 UTSW 9 20171167 missense probably damaging 1.00
R2221:Olfr870 UTSW 9 20171092 missense possibly damaging 0.86
R2270:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2271:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2272:Olfr870 UTSW 9 20171409 missense possibly damaging 0.73
R2509:Olfr870 UTSW 9 20171229 missense probably damaging 1.00
R2939:Olfr870 UTSW 9 20170765 missense probably benign
R2940:Olfr870 UTSW 9 20170765 missense probably benign
R3081:Olfr870 UTSW 9 20170765 missense probably benign
R4579:Olfr870 UTSW 9 20171114 missense probably damaging 1.00
R4667:Olfr870 UTSW 9 20171098 missense probably benign 0.04
R5681:Olfr870 UTSW 9 20170795 missense probably damaging 1.00
R5686:Olfr870 UTSW 9 20170969 missense possibly damaging 0.75
R5857:Olfr870 UTSW 9 20171239 missense probably damaging 1.00
R6561:Olfr870 UTSW 9 20170777 missense probably benign 0.01
R6842:Olfr870 UTSW 9 20171253 missense possibly damaging 0.95
R6987:Olfr870 UTSW 9 20170834 missense probably benign 0.03
R7674:Olfr870 UTSW 9 20171253 missense possibly damaging 0.95
R8375:Olfr870 UTSW 9 20170741 missense probably benign 0.04
R8445:Olfr870 UTSW 9 20171098 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTGTACAGAAGGACAACCGC -3'
(R):5'- CGCTGTGCTTGGGAATCTTC -3'

Sequencing Primer
(F):5'- GCAGCATCAATAGACTCTGTATCAG -3'
(R):5'- ATTCTGGCCGTCAGCATTG -3'
Posted On2019-10-24