Incidental Mutation 'R7641:Golga4'
ID590254
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Namegolgi autoantigen, golgin subfamily a, 4
Synonymsgolgin-245, Olp-1
MMRRC Submission
Accession Numbers

Genbank: NM_018748; MGI: 1859646  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7641 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location118506267-118582519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118557575 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1255 (R1255L)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]
Predicted Effect probably benign
Transcript: ENSMUST00000084820
AA Change: R1255L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: R1255L

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212097
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212274
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,519,307 Q641L probably benign Het
Aknad1 A T 3: 108,771,975 H474L probably benign Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Cars A G 7: 143,587,103 probably null Het
Chtf18 A T 17: 25,722,275 probably null Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Col6a5 T A 9: 105,881,426 R2194* probably null Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dock8 G A 19: 25,174,333 probably null Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Elf1 G A 14: 79,570,723 G205E probably damaging Het
Fsip2 A T 2: 82,986,912 K4330* probably null Het
Gm6525 A T 3: 84,174,843 T24S probably benign Het
Gpn2 A T 4: 133,588,659 Q243L probably null Het
Grb10 T C 11: 11,933,492 K588E possibly damaging Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
H2-M5 T A 17: 36,987,431 M331L probably benign Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Map3k20 T A 2: 72,398,361 L308H probably damaging Het
Mep1b T C 18: 21,094,977 F546L possibly damaging Het
Mier1 A G 4: 103,139,440 E133G possibly damaging Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pdyn A T 2: 129,689,828 V14E possibly damaging Het
Prdm16 T A 4: 154,345,444 H356L probably damaging Het
Rasa3 A G 8: 13,584,961 C453R probably benign Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rlf A G 4: 121,159,196 S315P probably damaging Het
Rusc2 C T 4: 43,425,335 R1147W possibly damaging Het
Sacs T A 14: 61,202,871 Y789N probably damaging Het
Sap130 T C 18: 31,653,623 L289P probably damaging Het
Sept3 A G 15: 82,290,782 Y308C probably damaging Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Slc2a13 A G 15: 91,272,156 *638Q probably null Het
Smchd1 T A 17: 71,390,479 E1155D probably benign Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tonsl C T 15: 76,633,652 D650N probably damaging Het
Tti1 A T 2: 158,009,029 F97I possibly damaging Het
Ttn T C 2: 76,742,210 Q26113R possibly damaging Het
Unc5d A T 8: 28,719,975 N444K probably damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r114 T C 17: 23,308,203 N452D possibly damaging Het
Vps16 T C 2: 130,440,528 V427A probably benign Het
Wdr5b T A 16: 36,042,342 V277D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zfp40 A G 17: 23,178,283 V80A possibly damaging Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118514271 critical splice donor site probably null
IGL00801:Golga4 APN 9 118538926 missense probably damaging 0.98
IGL01395:Golga4 APN 9 118535373 missense probably damaging 1.00
IGL01472:Golga4 APN 9 118532574 missense probably damaging 1.00
IGL01519:Golga4 APN 9 118527092 missense probably damaging 1.00
IGL01563:Golga4 APN 9 118527006 splice site probably benign
IGL02593:Golga4 APN 9 118555566 unclassified probably benign
IGL02803:Golga4 APN 9 118535460 missense probably benign
IGL02939:Golga4 APN 9 118535454 missense probably benign 0.01
IGL02939:Golga4 APN 9 118534632 missense probably damaging 1.00
IGL03123:Golga4 APN 9 118536885 missense probably damaging 1.00
IGL03334:Golga4 APN 9 118537233 splice site probably benign
F5770:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118553457 missense probably damaging 1.00
PIT4382001:Golga4 UTSW 9 118553453 missense possibly damaging 0.88
R0179:Golga4 UTSW 9 118560740 critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118568993 missense probably benign 0.00
R0362:Golga4 UTSW 9 118555785 missense probably benign 0.13
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0973:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R0974:Golga4 UTSW 9 118537273 missense probably damaging 1.00
R1128:Golga4 UTSW 9 118548784 missense probably benign 0.40
R1384:Golga4 UTSW 9 118565651 missense probably damaging 0.99
R1435:Golga4 UTSW 9 118535440 missense probably benign 0.00
R1513:Golga4 UTSW 9 118555732 missense probably benign 0.02
R1818:Golga4 UTSW 9 118572987 missense probably damaging 1.00
R2083:Golga4 UTSW 9 118532590 missense probably damaging 1.00
R2243:Golga4 UTSW 9 118556904 missense probably benign 0.06
R2355:Golga4 UTSW 9 118560742 missense probably benign 0.00
R2518:Golga4 UTSW 9 118556612 missense probably damaging 1.00
R2921:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118559343 missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118557380 missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118534647 missense probably benign 0.16
R3909:Golga4 UTSW 9 118558736 missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118538971 missense probably damaging 0.99
R4321:Golga4 UTSW 9 118556435 missense probably damaging 1.00
R4358:Golga4 UTSW 9 118551878 missense probably benign 0.16
R4483:Golga4 UTSW 9 118514186 missense probably damaging 1.00
R4515:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4518:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4519:Golga4 UTSW 9 118559008 missense probably benign 0.28
R4545:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4546:Golga4 UTSW 9 118556845 missense probably damaging 1.00
R4580:Golga4 UTSW 9 118557259 missense probably benign 0.00
R4918:Golga4 UTSW 9 118558145 missense probably damaging 1.00
R5007:Golga4 UTSW 9 118558300 missense probably benign
R5045:Golga4 UTSW 9 118565656 missense probably benign
R5232:Golga4 UTSW 9 118506558 critical splice donor site probably null
R5256:Golga4 UTSW 9 118556501 missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118559057 nonsense probably null
R5567:Golga4 UTSW 9 118558183 missense probably damaging 1.00
R5576:Golga4 UTSW 9 118553534 missense probably benign 0.13
R5771:Golga4 UTSW 9 118558283 missense probably damaging 0.96
R5807:Golga4 UTSW 9 118527130 missense probably damaging 0.99
R5860:Golga4 UTSW 9 118558106 missense probably damaging 1.00
R6012:Golga4 UTSW 9 118559696 missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118558627 nonsense probably null
R6299:Golga4 UTSW 9 118557370 missense probably benign 0.03
R6467:Golga4 UTSW 9 118536792 missense probably damaging 1.00
R6552:Golga4 UTSW 9 118514231 missense probably damaging 1.00
R6688:Golga4 UTSW 9 118514210 missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118548779 missense probably damaging 1.00
R6987:Golga4 UTSW 9 118558532 missense probably benign
R7212:Golga4 UTSW 9 118536840 missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118559495 missense probably benign
R7431:Golga4 UTSW 9 118559731 missense probably damaging 1.00
R7727:Golga4 UTSW 9 118548702 missense probably damaging 1.00
R7729:Golga4 UTSW 9 118556063 missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118532575 missense probably damaging 1.00
R7849:Golga4 UTSW 9 118559311 missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118556366 missense probably damaging 1.00
R7932:Golga4 UTSW 9 118559311 missense possibly damaging 0.93
R7974:Golga4 UTSW 9 118556366 missense probably damaging 1.00
RF022:Golga4 UTSW 9 118557989 missense probably damaging 1.00
V7583:Golga4 UTSW 9 118556075 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- ACAAGAGTCAGCTGAGGGTCTC -3'
(R):5'- CAGCTGATTGGTAACCTGCTG -3'

Sequencing Primer
(F):5'- TGAGGGTCTCCGAGCTGAC -3'
(R):5'- CCTGCTGAAAAGAGCTCTTTAGTG -3'
Posted On2019-10-24