Mutagenetix > Incidental Mutation

Incidental Mutation 'R7641:Golga4'

590254

Institutional Source

Beutler Lab

Gene Symbol

Golga4

Ensembl Gene

ENSMUSG00000038708

Gene Name

golgi autoantigen, golgin subfamily a, 4

Synonyms

golgin-245, Olp-1

MMRRC Submission

Accession Numbers

Genbank: NM_018748; MGI: 1859646

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7641 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118506267-118582519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 118557575 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1255 (R1255L)

Ref Sequence

ENSEMBL: ENSMUSP00000081880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097]

AlphaFold

Q91VW5

Predicted Effect

probably benign
Transcript: ENSMUST00000084820
AA Change: R1255L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: R1255L

Domain	Start	End	E-Value	Type
low complexity region	10	41	N/A	INTRINSIC
coiled coil region	157	241	N/A	INTRINSIC
internal_repeat_1	271	299	2.93e-5	PROSPERO
low complexity region	339	351	N/A	INTRINSIC
low complexity region	513	532	N/A	INTRINSIC
low complexity region	547	566	N/A	INTRINSIC
low complexity region	705	715	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
SCOP:d1epua_	940	1076	2e-3	SMART
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1161	1182	N/A	INTRINSIC
low complexity region	1204	1228	N/A	INTRINSIC
coiled coil region	1283	1496	N/A	INTRINSIC
internal_repeat_2	1500	1525	5.98e-5	PROSPERO
coiled coil region	1541	1715	N/A	INTRINSIC
low complexity region	1756	1778	N/A	INTRINSIC
internal_repeat_1	1811	1839	2.93e-5	PROSPERO
coiled coil region	1844	1883	N/A	INTRINSIC
internal_repeat_2	1899	1924	5.98e-5	PROSPERO
coiled coil region	1933	2160	N/A	INTRINSIC
Grip	2181	2225	1.38e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000212097

Predicted Effect

probably benign
Transcript: ENSMUST00000212183

Predicted Effect

probably benign
Transcript: ENSMUST00000212274

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam1a	T	A	5: 121,519,307	Q641L	probably benign	Het
Aknad1	A	T	3: 108,771,975	H474L	probably benign	Het
Alkal1	A	T	1: 6,389,488	Y96F	probably damaging	Het
Cars	A	G	7: 143,587,103		probably null	Het
Chtf18	A	T	17: 25,722,275		probably null	Het
Cog2	C	A	8: 124,537,882	N333K	probably damaging	Het
Col6a5	T	A	9: 105,881,426	R2194*	probably null	Het
Dnah14	A	T	1: 181,707,533	I2355L	probably benign	Het
Dock8	G	A	19: 25,174,333		probably null	Het
Dpy19l3	A	C	7: 35,695,309	D601E	probably damaging	Het
Elf1	G	A	14: 79,570,723	G205E	probably damaging	Het
Fsip2	A	T	2: 82,986,912	K4330*	probably null	Het
Gm6525	A	T	3: 84,174,843	T24S	probably benign	Het
Gpn2	A	T	4: 133,588,659	Q243L	probably null	Het
Grb10	T	C	11: 11,933,492	K588E	possibly damaging	Het
Gys1	T	C	7: 45,455,071	S641P	probably damaging	Het
H2-M5	T	A	17: 36,987,431	M331L	probably benign	Het
Ighv6-6	T	A	12: 114,435,217	I10L	probably benign	Het
Jmy	C	T	13: 93,442,599	R675Q	probably damaging	Het
Lonp2	A	T	8: 86,665,758	Q484L	probably benign	Het
Map3k20	T	A	2: 72,398,361	L308H	probably damaging	Het
Mep1b	T	C	18: 21,094,977	F546L	possibly damaging	Het
Mier1	A	G	4: 103,139,440	E133G	possibly damaging	Het
Msh3	C	A	13: 92,212,503	V1074L	probably benign	Het
Muc6	A	T	7: 141,639,825	L1645Q	unknown	Het
Nat10	G	A	2: 103,743,090	A354V	probably damaging	Het
Olfr870	A	G	9: 20,171,253	L106P	possibly damaging	Het
Pdyn	A	T	2: 129,689,828	V14E	possibly damaging	Het
Prdm16	T	A	4: 154,345,444	H356L	probably damaging	Het
Rasa3	A	G	8: 13,584,961	C453R	probably benign	Het
Rasgrf2	C	T	13: 92,131,406	S30N	possibly damaging	Het
Rlf	A	G	4: 121,159,196	S315P	probably damaging	Het
Rusc2	C	T	4: 43,425,335	R1147W	possibly damaging	Het
Sacs	T	A	14: 61,202,871	Y789N	probably damaging	Het
Sap130	T	C	18: 31,653,623	L289P	probably damaging	Het
Sept3	A	G	15: 82,290,782	Y308C	probably damaging	Het
Slc2a12	A	G	10: 22,693,994	D528G	probably damaging	Het
Slc2a13	A	G	15: 91,272,156	*638Q	probably null	Het
Smchd1	T	A	17: 71,390,479	E1155D	probably benign	Het
Sorcs2	G	A	5: 36,397,952	R32C	probably damaging	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Tonsl	C	T	15: 76,633,652	D650N	probably damaging	Het
Tti1	A	T	2: 158,009,029	F97I	possibly damaging	Het
Ttn	T	C	2: 76,742,210	Q26113R	possibly damaging	Het
Unc5d	A	T	8: 28,719,975	N444K	probably damaging	Het
Usp17la	A	T	7: 104,861,447	K420*	probably null	Het
Vmn2r114	T	C	17: 23,308,203	N452D	possibly damaging	Het
Vps16	T	C	2: 130,440,528	V427A	probably benign	Het
Wdr5b	T	A	16: 36,042,342	V277D	probably damaging	Het
Zan	T	A	5: 137,467,108	M462L	possibly damaging	Het
Zfp40	A	G	17: 23,178,283	V80A	possibly damaging	Het
Zfp930	A	T	8: 69,228,685	H344L	probably damaging	Het

Other mutations in Golga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00711:Golga4	APN	9	118514271	critical splice donor site	probably null
IGL00801:Golga4	APN	9	118538926	missense	probably damaging	0.98
IGL01395:Golga4	APN	9	118535373	missense	probably damaging	1.00
IGL01472:Golga4	APN	9	118532574	missense	probably damaging	1.00
IGL01519:Golga4	APN	9	118527092	missense	probably damaging	1.00
IGL01563:Golga4	APN	9	118527006	splice site	probably benign
IGL02593:Golga4	APN	9	118555566	unclassified	probably benign
IGL02803:Golga4	APN	9	118535460	missense	probably benign
IGL02939:Golga4	APN	9	118535454	missense	probably benign	0.01
IGL02939:Golga4	APN	9	118534632	missense	probably damaging	1.00
IGL03123:Golga4	APN	9	118536885	missense	probably damaging	1.00
IGL03334:Golga4	APN	9	118537233	splice site	probably benign
F5770:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62
F6893:Golga4	UTSW	9	118553457	missense	probably damaging	1.00
PIT4382001:Golga4	UTSW	9	118553453	missense	possibly damaging	0.88
R0179:Golga4	UTSW	9	118560740	critical splice acceptor site	probably null
R0279:Golga4	UTSW	9	118568993	missense	probably benign	0.00
R0362:Golga4	UTSW	9	118555785	missense	probably benign	0.13
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0974:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R1128:Golga4	UTSW	9	118548784	missense	probably benign	0.40
R1384:Golga4	UTSW	9	118565651	missense	probably damaging	0.99
R1435:Golga4	UTSW	9	118535440	missense	probably benign	0.00
R1513:Golga4	UTSW	9	118555732	missense	probably benign	0.02
R1818:Golga4	UTSW	9	118572987	missense	probably damaging	1.00
R2083:Golga4	UTSW	9	118532590	missense	probably damaging	1.00
R2243:Golga4	UTSW	9	118556904	missense	probably benign	0.06
R2355:Golga4	UTSW	9	118560742	missense	probably benign	0.00
R2518:Golga4	UTSW	9	118556612	missense	probably damaging	1.00
R2921:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2922:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2923:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R3121:Golga4	UTSW	9	118557380	missense	possibly damaging	0.68
R3424:Golga4	UTSW	9	118534647	missense	probably benign	0.16
R3909:Golga4	UTSW	9	118558736	missense	possibly damaging	0.82
R3913:Golga4	UTSW	9	118538971	missense	probably damaging	0.99
R4321:Golga4	UTSW	9	118556435	missense	probably damaging	1.00
R4358:Golga4	UTSW	9	118551878	missense	probably benign	0.16
R4483:Golga4	UTSW	9	118514186	missense	probably damaging	1.00
R4515:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4518:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4519:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4545:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4546:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4580:Golga4	UTSW	9	118557259	missense	probably benign	0.00
R4918:Golga4	UTSW	9	118558145	missense	probably damaging	1.00
R5007:Golga4	UTSW	9	118558300	missense	probably benign
R5045:Golga4	UTSW	9	118565656	missense	probably benign
R5232:Golga4	UTSW	9	118506558	critical splice donor site	probably null
R5256:Golga4	UTSW	9	118556501	missense	possibly damaging	0.93
R5502:Golga4	UTSW	9	118559057	nonsense	probably null
R5567:Golga4	UTSW	9	118558183	missense	probably damaging	1.00
R5576:Golga4	UTSW	9	118553534	missense	probably benign	0.13
R5771:Golga4	UTSW	9	118558283	missense	probably damaging	0.96
R5807:Golga4	UTSW	9	118527130	missense	probably damaging	0.99
R5860:Golga4	UTSW	9	118558106	missense	probably damaging	1.00
R6012:Golga4	UTSW	9	118559696	missense	possibly damaging	0.90
R6285:Golga4	UTSW	9	118558627	nonsense	probably null
R6299:Golga4	UTSW	9	118557370	missense	probably benign	0.03
R6467:Golga4	UTSW	9	118536792	missense	probably damaging	1.00
R6552:Golga4	UTSW	9	118514231	missense	probably damaging	1.00
R6688:Golga4	UTSW	9	118514210	missense	possibly damaging	0.66
R6965:Golga4	UTSW	9	118548779	missense	probably damaging	1.00
R6987:Golga4	UTSW	9	118558532	missense	probably benign
R7212:Golga4	UTSW	9	118536840	missense	possibly damaging	0.80
R7426:Golga4	UTSW	9	118559495	missense	probably benign
R7431:Golga4	UTSW	9	118559731	missense	probably damaging	1.00
R7727:Golga4	UTSW	9	118548702	missense	probably damaging	1.00
R7729:Golga4	UTSW	9	118556063	missense	possibly damaging	0.51
R7811:Golga4	UTSW	9	118532575	missense	probably damaging	1.00
R7849:Golga4	UTSW	9	118559311	missense	possibly damaging	0.93
R7891:Golga4	UTSW	9	118556366	missense	probably damaging	1.00
R7976:Golga4	UTSW	9	118536768	missense	possibly damaging	0.49
R8275:Golga4	UTSW	9	118532559	missense	probably damaging	1.00
R8378:Golga4	UTSW	9	118558322	missense	probably benign	0.03
R8514:Golga4	UTSW	9	118555796	missense	possibly damaging	0.47
R8698:Golga4	UTSW	9	118555961	missense	probably damaging	0.97
R8856:Golga4	UTSW	9	118556711	missense	probably damaging	0.98
R9227:Golga4	UTSW	9	118556873	missense	possibly damaging	0.94
R9282:Golga4	UTSW	9	118556825	missense	probably damaging	1.00
RF022:Golga4	UTSW	9	118557989	missense	probably damaging	1.00
V7583:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- ACAAGAGTCAGCTGAGGGTCTC -3'
(R):5'- CAGCTGATTGGTAACCTGCTG -3'

Sequencing Primer
(F):5'- TGAGGGTCTCCGAGCTGAC -3'
(R):5'- CCTGCTGAAAAGAGCTCTTTAGTG -3'

Posted On

2019-10-24