Incidental Mutation 'R7641:Rasgrf2'
ID590258
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene NameRAS protein-specific guanine nucleotide-releasing factor 2
SynonymsGrf2, 6330417G04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R7641 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location91880400-92131656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 92131406 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 30 (S30N)
Ref Sequence ENSEMBL: ENSMUSP00000096930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000146492] [ENSMUST00000216219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099326
AA Change: S30N

PolyPhen 2 Score 0.649 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: S30N

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146492
AA Change: S30N

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116203
Gene: ENSMUSG00000021708
AA Change: S30N

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
Pfam:RhoGEF 247 387 1.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216219
AA Change: S30N

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,519,307 Q641L probably benign Het
Aknad1 A T 3: 108,771,975 H474L probably benign Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Cars A G 7: 143,587,103 probably null Het
Chtf18 A T 17: 25,722,275 probably null Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Col6a5 T A 9: 105,881,426 R2194* probably null Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dock8 G A 19: 25,174,333 probably null Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Elf1 G A 14: 79,570,723 G205E probably damaging Het
Fsip2 A T 2: 82,986,912 K4330* probably null Het
Gm6525 A T 3: 84,174,843 T24S probably benign Het
Golga4 G T 9: 118,557,575 R1255L probably benign Het
Gpn2 A T 4: 133,588,659 Q243L probably null Het
Grb10 T C 11: 11,933,492 K588E possibly damaging Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
H2-M5 T A 17: 36,987,431 M331L probably benign Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Map3k20 T A 2: 72,398,361 L308H probably damaging Het
Mep1b T C 18: 21,094,977 F546L possibly damaging Het
Mier1 A G 4: 103,139,440 E133G possibly damaging Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pdyn A T 2: 129,689,828 V14E possibly damaging Het
Prdm16 T A 4: 154,345,444 H356L probably damaging Het
Rasa3 A G 8: 13,584,961 C453R probably benign Het
Rlf A G 4: 121,159,196 S315P probably damaging Het
Rusc2 C T 4: 43,425,335 R1147W possibly damaging Het
Sacs T A 14: 61,202,871 Y789N probably damaging Het
Sap130 T C 18: 31,653,623 L289P probably damaging Het
Sept3 A G 15: 82,290,782 Y308C probably damaging Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Slc2a13 A G 15: 91,272,156 *638Q probably null Het
Smchd1 T A 17: 71,390,479 E1155D probably benign Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tonsl C T 15: 76,633,652 D650N probably damaging Het
Tti1 A T 2: 158,009,029 F97I possibly damaging Het
Ttn T C 2: 76,742,210 Q26113R possibly damaging Het
Unc5d A T 8: 28,719,975 N444K probably damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r114 T C 17: 23,308,203 N452D possibly damaging Het
Vps16 T C 2: 130,440,528 V427A probably benign Het
Wdr5b T A 16: 36,042,342 V277D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zfp40 A G 17: 23,178,283 V80A possibly damaging Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92022917 splice site probably benign
IGL01358:Rasgrf2 APN 13 91982630 missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92038210 missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 91982738 missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 91988026 missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92131392 missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92030765 missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 91983633 missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92022905 missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 91987979 missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 91896051 missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 91919817 splice site probably benign
R0632:Rasgrf2 UTSW 13 91972274 missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 91982771 missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92028666 missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 91887689 missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92030888 missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 91983676 missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 91896086 missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 91890664 missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 91902621 missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 91969030 missense probably benign
R1934:Rasgrf2 UTSW 13 91983706 splice site probably null
R1990:Rasgrf2 UTSW 13 92035965 missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 91902629 missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92030843 missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 91972255 missense probably benign
R2193:Rasgrf2 UTSW 13 92023713 splice site probably null
R2406:Rasgrf2 UTSW 13 91972240 missense probably benign
R3055:Rasgrf2 UTSW 13 92029075 missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92030788 missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 91982654 missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 91885654 nonsense probably null
R4576:Rasgrf2 UTSW 13 91896410 missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92038281 missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 91990830 critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 91983661 missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 91988016 missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92023682 missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 91896036 missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92131433 missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 91919892 missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92029101 missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92030785 missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92131446 missense probably benign
R6428:Rasgrf2 UTSW 13 91987981 missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92030853 missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92028519 missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 91885635 missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 91983613 missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 91982833 missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92022592 intron probably benign
R7056:Rasgrf2 UTSW 13 92030695 missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 91886402 missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 91884518 nonsense probably null
R7392:Rasgrf2 UTSW 13 91893737 missense
R7469:Rasgrf2 UTSW 13 92029022 critical splice donor site probably null
R7618:Rasgrf2 UTSW 13 91987966 missense
R7674:Rasgrf2 UTSW 13 92131406 missense possibly damaging 0.65
R7784:Rasgrf2 UTSW 13 91896082 missense
R7962:Rasgrf2 UTSW 13 92030792 missense probably damaging 0.99
R8056:Rasgrf2 UTSW 13 92030813 missense probably damaging 0.97
R8218:Rasgrf2 UTSW 13 91982677 missense
X0013:Rasgrf2 UTSW 13 92030855 missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 91902535 missense probably damaging 0.99
Z1177:Rasgrf2 UTSW 13 91983513 missense
Z1177:Rasgrf2 UTSW 13 92022573 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGTACCTGCTTGTCCAAAG -3'
(R):5'- TACTTCGGGTGGAGTGACAC -3'

Sequencing Primer
(F):5'- TTGTCCAAAGCGTCCCG -3'
(R):5'- ATAGGCGCCCTAGGTCTG -3'
Posted On2019-10-24