Incidental Mutation 'R0234:Ghrhr'
ID59026
Institutional Source Beutler Lab
Gene Symbol Ghrhr
Ensembl Gene ENSMUSG00000004654
Gene Namegrowth hormone releasing hormone receptor
SynonymsGhrfr
MMRRC Submission 038475-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0234 (G1)
Quality Score204
Status Not validated
Chromosome6
Chromosomal Location55376295-55388530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55379186 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 88 (D88V)
Ref Sequence ENSEMBL: ENSMUSP00000145224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063578] [ENSMUST00000203241]
Predicted Effect probably benign
Transcript: ENSMUST00000063578
AA Change: D88V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000068120
Gene: ENSMUSG00000004654
AA Change: D88V

DomainStartEndE-ValueType
HormR 51 121 1.3e-26 SMART
Pfam:7tm_2 126 372 7.2e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203241
AA Change: D88V

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145224
Gene: ENSMUSG00000004654
AA Change: D88V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
HormR 51 121 8.4e-29 SMART
Pfam:7tm_2 126 374 8.7e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204988
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for growth hormone-releasing hormone. Binding of this hormone to the receptor leads to synthesis and release of growth hormone. Mutations in this gene have been associated with isolated growth hormone deficiency (IGHD), also known as Dwarfism of Sindh, a disorder characterized by short stature. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for a spontaneous null mutation exhibit reduced growth from 2 weeks of age, impaired growth hormone synthesis and release, obesity, decreased bone mass, reduced fertility in males, impaired first lactations, and extended life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T A 7: 131,194,303 probably null Het
A3galt2 A G 4: 128,767,148 R197G possibly damaging Het
Acacb A T 5: 114,209,817 H983L probably damaging Het
Adal T A 2: 121,148,317 D139E probably benign Het
Adam6b G A 12: 113,490,610 R349H probably damaging Het
Agap1 A G 1: 89,671,212 K331E probably damaging Het
Alyref T C 11: 120,598,307 D11G probably damaging Het
B3gat1 A G 9: 26,756,081 E203G probably damaging Het
Bsn T C 9: 108,116,396 E719G possibly damaging Het
Cap2 G C 13: 46,638,022 probably null Het
Ccni A G 5: 93,202,327 V31A probably benign Het
Cfap54 A T 10: 92,899,160 L2343* probably null Het
Clns1a T A 7: 97,714,032 Y204N possibly damaging Het
Cox11 C T 11: 90,644,500 T259I probably damaging Het
D430042O09Rik T C 7: 125,795,385 V211A probably benign Het
Dsp A G 13: 38,187,893 N940S probably benign Het
Erbb2 T C 11: 98,436,439 V1181A probably benign Het
Exoc4 T C 6: 33,862,087 V686A possibly damaging Het
F830045P16Rik A G 2: 129,463,464 V330A possibly damaging Het
Fam71a T C 1: 191,162,908 S513G probably benign Het
Fbf1 A C 11: 116,155,034 F245V probably damaging Het
Fut10 T A 8: 31,236,197 F327I probably damaging Het
Galnt1 C T 18: 24,254,633 P144S probably damaging Het
Greb1l T A 18: 10,560,331 C1864S probably damaging Het
Hist1h1c T C 13: 23,739,123 I92T probably benign Het
Hps1 T C 19: 42,762,553 E336G probably damaging Het
Ibsp GGAAGAAGAAGAAGAAGA GGAAGAAGAAGAAGA 5: 104,310,069 probably benign Het
Irgc1 C A 7: 24,433,328 E21D possibly damaging Het
Itsn1 A T 16: 91,828,280 R590* probably null Het
Lmln T C 16: 33,066,324 V67A probably damaging Het
Lsm14a T C 7: 34,365,617 Q179R probably damaging Het
Ltbr A C 6: 125,312,873 D119E probably benign Het
Mrc1 A G 2: 14,279,894 T565A possibly damaging Het
Muc6 A C 7: 141,649,674 N473K possibly damaging Het
Myocd A T 11: 65,187,240 D448E probably benign Het
Neil2 T A 14: 63,183,526 I239F probably damaging Het
Npnt A G 3: 132,914,414 F123S possibly damaging Het
Olfr1164 T A 2: 88,093,022 R305* probably null Het
Olfr117 T A 17: 37,660,106 I76F probably damaging Het
Olfr1309 T C 2: 111,983,300 Y258C probably damaging Het
Olfr1501 C T 19: 13,838,538 V212M possibly damaging Het
Olfr683 T C 7: 105,144,074 D73G probably damaging Het
Olfr686 C A 7: 105,203,614 C243F probably damaging Het
Olfr933 A C 9: 38,976,251 probably null Het
Pcnx3 T C 19: 5,672,618 T941A probably benign Het
Phldb3 G A 7: 24,612,579 R106Q probably benign Het
Pitrm1 C A 13: 6,575,079 Y864* probably null Het
Plcb4 T C 2: 135,982,075 I844T probably benign Het
Plekhg5 T C 4: 152,112,219 C695R probably damaging Het
Ppp1r3b T A 8: 35,384,501 F165I probably damaging Het
Prr5 T A 15: 84,703,121 F357L probably damaging Het
Rasgrf1 A T 9: 90,009,366 I1046F probably damaging Het
Rbm15b T C 9: 106,885,364 Y535C probably damaging Het
Rbp3 A T 14: 33,955,901 E602V probably damaging Het
Rimklb T C 6: 122,456,333 N343S probably benign Het
Rrp12 A G 19: 41,871,760 L1008P probably damaging Het
Sec63 C T 10: 42,798,798 R226C probably damaging Het
Sirpa T C 2: 129,615,468 V154A probably damaging Het
Slc13a5 C G 11: 72,250,800 V405L probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc22a23 G A 13: 34,183,261 T588I probably damaging Het
Slc22a27 C A 19: 7,926,791 probably benign Het
Slc4a4 A C 5: 89,156,336 H502P possibly damaging Het
Slc5a5 A T 8: 70,889,633 M258K probably damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Stk11ip A G 1: 75,529,067 D460G possibly damaging Het
Syn3 T A 10: 86,448,886 I117F possibly damaging Het
Tead4 C T 6: 128,243,402 A224T probably damaging Het
Tmtc3 A T 10: 100,450,322 N546K probably benign Het
Tnn T A 1: 160,088,466 H1227L probably damaging Het
Tor2a G A 2: 32,758,704 G62D probably damaging Het
Trf T C 9: 103,226,879 probably null Het
Ubr5 T C 15: 37,968,493 T2727A probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Wipf3 T G 6: 54,496,501 L458R probably damaging Het
Zfp236 T C 18: 82,629,994 K966R probably damaging Het
Zfp27 T A 7: 29,894,107 H811L possibly damaging Het
Zfp366 A G 13: 99,234,260 H496R probably damaging Het
Zfp467 A T 6: 48,438,755 V321E probably damaging Het
Other mutations in Ghrhr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Ghrhr APN 6 55379125 missense probably benign 0.00
IGL01088:Ghrhr APN 6 55379193 critical splice donor site probably null
IGL01567:Ghrhr APN 6 55384123 missense probably damaging 1.00
IGL02351:Ghrhr APN 6 55384153 missense probably damaging 1.00
IGL02358:Ghrhr APN 6 55384153 missense probably damaging 1.00
IGL02588:Ghrhr APN 6 55383410 missense probably damaging 1.00
IGL03010:Ghrhr APN 6 55384757 missense probably damaging 1.00
R0068:Ghrhr UTSW 6 55380864 splice site probably benign
R0068:Ghrhr UTSW 6 55380864 splice site probably benign
R0234:Ghrhr UTSW 6 55379186 missense possibly damaging 0.47
R1173:Ghrhr UTSW 6 55388269 nonsense probably null
R1174:Ghrhr UTSW 6 55388269 nonsense probably null
R1175:Ghrhr UTSW 6 55388269 nonsense probably null
R1613:Ghrhr UTSW 6 55379697 missense probably damaging 0.99
R2196:Ghrhr UTSW 6 55379741 missense probably damaging 1.00
R2232:Ghrhr UTSW 6 55385459 missense probably damaging 1.00
R3764:Ghrhr UTSW 6 55380771 missense probably damaging 0.98
R4618:Ghrhr UTSW 6 55381754 missense probably damaging 1.00
R4837:Ghrhr UTSW 6 55388187 missense probably damaging 1.00
R5422:Ghrhr UTSW 6 55388203 missense probably benign 0.00
R6199:Ghrhr UTSW 6 55379188 missense probably benign 0.03
R6915:Ghrhr UTSW 6 55383119 intron probably null
R7632:Ghrhr UTSW 6 55384742 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTCAGCACTGCCATTCAGAATCTCC -3'
(R):5'- CTCTGTTCTCCAGGAAAGCTCTGC -3'

Sequencing Primer
(F):5'- AGAATCTCCTCCCTCATAGGTTAC -3'
(R):5'- GTGGAATGATGGACCTCTACATCC -3'
Posted On2013-07-11