Incidental Mutation 'R7641:Tonsl'
ID590263
Institutional Source Beutler Lab
Gene Symbol Tonsl
Ensembl Gene ENSMUSG00000059323
Gene Nametonsoku-like, DNA repair protein
SynonymsNfkbil2, 2810439M11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7641 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76626002-76639958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76633652 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 650 (D650N)
Ref Sequence ENSEMBL: ENSMUSP00000129597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165190] [ENSMUST00000168185]
Predicted Effect probably benign
Transcript: ENSMUST00000165163
SMART Domains Protein: ENSMUSP00000131229
Gene: ENSMUSG00000059323

DomainStartEndE-ValueType
low complexity region 33 51 N/A INTRINSIC
low complexity region 52 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165190
SMART Domains Protein: ENSMUSP00000131368
Gene: ENSMUSG00000059323

DomainStartEndE-ValueType
TPR 27 60 5.33e1 SMART
Blast:TPR 67 100 4e-9 BLAST
TPR 162 195 1.77e1 SMART
TPR 202 235 1.36e1 SMART
low complexity region 259 271 N/A INTRINSIC
TPR 311 344 1.4e1 SMART
TPR 352 385 7.27e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168185
AA Change: D650N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129597
Gene: ENSMUSG00000059323
AA Change: D650N

DomainStartEndE-ValueType
TPR 27 60 5.33e1 SMART
Blast:TPR 67 100 7e-9 BLAST
TPR 162 195 1.77e1 SMART
TPR 202 235 1.36e1 SMART
Pfam:TPR_8 242 274 8.7e-3 PFAM
TPR 311 344 1.4e1 SMART
TPR 352 385 7.27e0 SMART
low complexity region 413 437 N/A INTRINSIC
low complexity region 465 494 N/A INTRINSIC
low complexity region 500 511 N/A INTRINSIC
ANK 528 559 8.36e1 SMART
ANK 561 590 4.85e-8 SMART
ANK 597 626 2.85e-5 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
LRR 1058 1085 2.86e-1 SMART
LRR 1086 1113 5.88e-1 SMART
LRR 1117 1144 1.67e-2 SMART
LRR 1177 1204 2.72e0 SMART
LRR 1236 1263 7.02e0 SMART
LRR 1264 1292 1.46e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a negative regulator of NF-kappa-B mediated transcription. The encoded protein may bind NF-kappa-B complexes and trap them in the cytoplasm, preventing them from entering the nucleus and interacting with the DNA. Phosphorylation of this protein targets it for degradation by the ubiquitination pathway, which frees the NF-kappa-B complexes to enter the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,519,307 Q641L probably benign Het
Aknad1 A T 3: 108,771,975 H474L probably benign Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Cars A G 7: 143,587,103 probably null Het
Chtf18 A T 17: 25,722,275 probably null Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Col6a5 T A 9: 105,881,426 R2194* probably null Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dock8 G A 19: 25,174,333 probably null Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Elf1 G A 14: 79,570,723 G205E probably damaging Het
Fsip2 A T 2: 82,986,912 K4330* probably null Het
Gm6525 A T 3: 84,174,843 T24S probably benign Het
Golga4 G T 9: 118,557,575 R1255L probably benign Het
Gpn2 A T 4: 133,588,659 Q243L probably null Het
Grb10 T C 11: 11,933,492 K588E possibly damaging Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
H2-M5 T A 17: 36,987,431 M331L probably benign Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Map3k20 T A 2: 72,398,361 L308H probably damaging Het
Mep1b T C 18: 21,094,977 F546L possibly damaging Het
Mier1 A G 4: 103,139,440 E133G possibly damaging Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pdyn A T 2: 129,689,828 V14E possibly damaging Het
Prdm16 T A 4: 154,345,444 H356L probably damaging Het
Rasa3 A G 8: 13,584,961 C453R probably benign Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rlf A G 4: 121,159,196 S315P probably damaging Het
Rusc2 C T 4: 43,425,335 R1147W possibly damaging Het
Sacs T A 14: 61,202,871 Y789N probably damaging Het
Sap130 T C 18: 31,653,623 L289P probably damaging Het
Sept3 A G 15: 82,290,782 Y308C probably damaging Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Slc2a13 A G 15: 91,272,156 *638Q probably null Het
Smchd1 T A 17: 71,390,479 E1155D probably benign Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tti1 A T 2: 158,009,029 F97I possibly damaging Het
Ttn T C 2: 76,742,210 Q26113R possibly damaging Het
Unc5d A T 8: 28,719,975 N444K probably damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r114 T C 17: 23,308,203 N452D possibly damaging Het
Vps16 T C 2: 130,440,528 V427A probably benign Het
Wdr5b T A 16: 36,042,342 V277D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zfp40 A G 17: 23,178,283 V80A possibly damaging Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Tonsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tonsl APN 15 76638496 missense possibly damaging 0.78
IGL00763:Tonsl APN 15 76633868 missense probably damaging 1.00
IGL00796:Tonsl APN 15 76625149 missense probably benign
IGL00965:Tonsl APN 15 76631880 splice site probably benign
IGL01434:Tonsl APN 15 76631102 missense probably benign 0.11
IGL01859:Tonsl APN 15 76634780 missense probably damaging 0.97
IGL02112:Tonsl APN 15 76633402 missense probably benign 0.01
IGL02189:Tonsl APN 15 76623178 missense possibly damaging 0.56
IGL02281:Tonsl APN 15 76634074 missense probably damaging 1.00
IGL02627:Tonsl APN 15 76634095 missense probably damaging 0.99
IGL02750:Tonsl APN 15 76633389 missense probably damaging 0.97
IGL02977:Tonsl APN 15 76632873 missense probably benign 0.00
R0127:Tonsl UTSW 15 76633485 missense probably benign 0.01
R0316:Tonsl UTSW 15 76629300 missense possibly damaging 0.68
R0443:Tonsl UTSW 15 76639684 missense probably benign
R0714:Tonsl UTSW 15 76633721 splice site probably benign
R0946:Tonsl UTSW 15 76623221 missense probably benign 0.03
R0975:Tonsl UTSW 15 76638932 missense probably damaging 0.99
R1263:Tonsl UTSW 15 76622562 missense possibly damaging 0.85
R1468:Tonsl UTSW 15 76636561 critical splice donor site probably null
R1468:Tonsl UTSW 15 76636561 critical splice donor site probably null
R1610:Tonsl UTSW 15 76638557 missense probably damaging 1.00
R1623:Tonsl UTSW 15 76638509 missense probably damaging 1.00
R1763:Tonsl UTSW 15 76638066 missense probably damaging 1.00
R1882:Tonsl UTSW 15 76624150 missense possibly damaging 0.83
R1898:Tonsl UTSW 15 76638853 unclassified probably null
R1932:Tonsl UTSW 15 76624597 missense probably damaging 0.97
R2141:Tonsl UTSW 15 76632661 missense probably damaging 0.99
R2166:Tonsl UTSW 15 76637313 missense probably benign 0.13
R2191:Tonsl UTSW 15 76632680 missense probably damaging 0.96
R2198:Tonsl UTSW 15 76636672 missense probably benign 0.00
R2219:Tonsl UTSW 15 76634640 missense probably damaging 1.00
R2762:Tonsl UTSW 15 76630620 missense probably damaging 1.00
R3156:Tonsl UTSW 15 76639521 missense probably damaging 1.00
R3508:Tonsl UTSW 15 76639756 missense probably benign
R4012:Tonsl UTSW 15 76637044 missense probably damaging 1.00
R4179:Tonsl UTSW 15 76624475 missense probably damaging 1.00
R4180:Tonsl UTSW 15 76624475 missense probably damaging 1.00
R4327:Tonsl UTSW 15 76639716 missense probably benign
R4627:Tonsl UTSW 15 76637224 missense probably damaging 1.00
R4671:Tonsl UTSW 15 76623410 missense probably benign 0.01
R4825:Tonsl UTSW 15 76633248 missense probably benign 0.34
R4840:Tonsl UTSW 15 76633209 missense probably benign
R5030:Tonsl UTSW 15 76638101 missense probably damaging 1.00
R5143:Tonsl UTSW 15 76636657 missense possibly damaging 0.80
R6238:Tonsl UTSW 15 76636218 unclassified probably null
R6379:Tonsl UTSW 15 76629742 missense probably benign
R6401:Tonsl UTSW 15 76633666 missense probably damaging 1.00
R6534:Tonsl UTSW 15 76629677 missense probably damaging 1.00
R6695:Tonsl UTSW 15 76629818 missense possibly damaging 0.84
R6701:Tonsl UTSW 15 76629300 missense probably damaging 1.00
R7138:Tonsl UTSW 15 76634776 missense probably benign
R7206:Tonsl UTSW 15 76633651 missense probably damaging 1.00
R7287:Tonsl UTSW 15 76633725 intron probably null
R7615:Tonsl UTSW 15 76630607 missense probably benign 0.44
R7626:Tonsl UTSW 15 76633936 missense probably null 1.00
Z1177:Tonsl UTSW 15 76636153 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGGGTCAAATAGATGGTTACTTGG -3'
(R):5'- TGGCCACTTTGAGGTAGCTG -3'

Sequencing Primer
(F):5'- CAAATAGATGGTTACTTGGAATGGTC -3'
(R):5'- GCCACTTTGAGGTAGCTGAATTACTC -3'
Posted On2019-10-24