Incidental Mutation 'R7641:Wdr5b'
ID590266
Institutional Source Beutler Lab
Gene Symbol Wdr5b
Ensembl Gene ENSMUSG00000034379
Gene NameWD repeat domain 5B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R7641 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location36041190-36043928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36042342 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 277 (V277D)
Ref Sequence ENSEMBL: ENSMUSP00000040852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004057] [ENSMUST00000042203] [ENSMUST00000231351]
Predicted Effect probably benign
Transcript: ENSMUST00000004057
SMART Domains Protein: ENSMUSP00000004057
Gene: ENSMUSG00000003955

DomainStartEndE-ValueType
Pfam:DUF1075 10 155 1.8e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042203
AA Change: V277D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040852
Gene: ENSMUSG00000034379
AA Change: V277D

DomainStartEndE-ValueType
WD40 28 67 5.95e-7 SMART
WD40 70 109 1.28e-11 SMART
WD40 112 151 4.87e-12 SMART
WD40 154 193 5.22e-12 SMART
WD40 196 236 1.21e-7 SMART
WD40 239 281 5.47e-6 SMART
WD40 284 325 1.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231351
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a protein containing several WD40 repeats. WD repeats are approximately 30- to 40-amino acid domains containing several conserved residues, including a trp-asp at the C-terminal end. The encoded protein may mediate protein-protein interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,519,307 Q641L probably benign Het
Aknad1 A T 3: 108,771,975 H474L probably benign Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Cars A G 7: 143,587,103 probably null Het
Chtf18 A T 17: 25,722,275 probably null Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Col6a5 T A 9: 105,881,426 R2194* probably null Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dock8 G A 19: 25,174,333 probably null Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Elf1 G A 14: 79,570,723 G205E probably damaging Het
Fsip2 A T 2: 82,986,912 K4330* probably null Het
Gm6525 A T 3: 84,174,843 T24S probably benign Het
Golga4 G T 9: 118,557,575 R1255L probably benign Het
Gpn2 A T 4: 133,588,659 Q243L probably null Het
Grb10 T C 11: 11,933,492 K588E possibly damaging Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
H2-M5 T A 17: 36,987,431 M331L probably benign Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Map3k20 T A 2: 72,398,361 L308H probably damaging Het
Mep1b T C 18: 21,094,977 F546L possibly damaging Het
Mier1 A G 4: 103,139,440 E133G possibly damaging Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pdyn A T 2: 129,689,828 V14E possibly damaging Het
Prdm16 T A 4: 154,345,444 H356L probably damaging Het
Rasa3 A G 8: 13,584,961 C453R probably benign Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rlf A G 4: 121,159,196 S315P probably damaging Het
Rusc2 C T 4: 43,425,335 R1147W possibly damaging Het
Sacs T A 14: 61,202,871 Y789N probably damaging Het
Sap130 T C 18: 31,653,623 L289P probably damaging Het
Sept3 A G 15: 82,290,782 Y308C probably damaging Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Slc2a13 A G 15: 91,272,156 *638Q probably null Het
Smchd1 T A 17: 71,390,479 E1155D probably benign Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tonsl C T 15: 76,633,652 D650N probably damaging Het
Tti1 A T 2: 158,009,029 F97I possibly damaging Het
Ttn T C 2: 76,742,210 Q26113R possibly damaging Het
Unc5d A T 8: 28,719,975 N444K probably damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r114 T C 17: 23,308,203 N452D possibly damaging Het
Vps16 T C 2: 130,440,528 V427A probably benign Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zfp40 A G 17: 23,178,283 V80A possibly damaging Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Wdr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Wdr5b APN 16 36042263 missense probably damaging 1.00
R0605:Wdr5b UTSW 16 36041996 missense probably benign 0.00
R0627:Wdr5b UTSW 16 36042470 missense probably benign 0.07
R5280:Wdr5b UTSW 16 36041832 missense probably benign 0.16
R5977:Wdr5b UTSW 16 36042004 missense probably damaging 1.00
R6899:Wdr5b UTSW 16 36041780 missense probably damaging 1.00
R7236:Wdr5b UTSW 16 36041838 missense possibly damaging 0.88
R7246:Wdr5b UTSW 16 36041936 missense probably damaging 1.00
R8063:Wdr5b UTSW 16 36041788 missense possibly damaging 0.78
Z1088:Wdr5b UTSW 16 36042443 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGAAGGCAACCCTCCAGTG -3'
(R):5'- AATCCAGAGAGACCATCCTTTG -3'

Sequencing Primer
(F):5'- GGCAACCCTCCAGTGTCTTTTG -3'
(R):5'- TTTCCTCATCGCCTGCCAGAG -3'
Posted On2019-10-24