Incidental Mutation 'R7641:Mep1b'
ID590271
Institutional Source Beutler Lab
Gene Symbol Mep1b
Ensembl Gene ENSMUSG00000024313
Gene Namemeprin 1 beta
SynonymsMep-1b, meprin beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R7641 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location21072344-21100199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21094977 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 546 (F546L)
Ref Sequence ENSEMBL: ENSMUSP00000080866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082235]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082235
AA Change: F546L

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080866
Gene: ENSMUSG00000024313
AA Change: F546L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 30 42 N/A INTRINSIC
ZnMc 68 208 1.23e-54 SMART
MAM 261 430 1.91e-52 SMART
MATH 433 569 4.88e-8 SMART
EGF 610 647 2.35e-2 SMART
transmembrane domain 658 680 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meprins are multidomain zinc metalloproteases that are highly expressed in mammalian kidney and intestinal brush border membranes, and in leukocytes and certain cancer cells. They are involved in the hydrolysis of a variety of peptide and protein substrates, and have been implicated in cancer and intestinal inflammation. Mature meprins are oligomers of evolutionarily related, but separately encoded alpha and/or beta subunits. Homooligomers of alpha subunit are secreted, whereas, oligomers containing the beta subunit are plasma membrane-bound. This gene encodes the beta subunit. Targeted disruption of this gene in mice affects embryonic viability, renal gene expression profiles, and distribution of the membrane-associated alpha subunit in kidney and intestine. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit 50% prenatal lethality; survivors have reduced birth weight and show altered renal gene expression, but otherwise are apparently normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1a T A 5: 121,519,307 Q641L probably benign Het
Aknad1 A T 3: 108,771,975 H474L probably benign Het
Alkal1 A T 1: 6,389,488 Y96F probably damaging Het
Cars A G 7: 143,587,103 probably null Het
Chtf18 A T 17: 25,722,275 probably null Het
Cog2 C A 8: 124,537,882 N333K probably damaging Het
Col6a5 T A 9: 105,881,426 R2194* probably null Het
Dnah14 A T 1: 181,707,533 I2355L probably benign Het
Dock8 G A 19: 25,174,333 probably null Het
Dpy19l3 A C 7: 35,695,309 D601E probably damaging Het
Elf1 G A 14: 79,570,723 G205E probably damaging Het
Fsip2 A T 2: 82,986,912 K4330* probably null Het
Gm6525 A T 3: 84,174,843 T24S probably benign Het
Golga4 G T 9: 118,557,575 R1255L probably benign Het
Gpn2 A T 4: 133,588,659 Q243L probably null Het
Grb10 T C 11: 11,933,492 K588E possibly damaging Het
Gys1 T C 7: 45,455,071 S641P probably damaging Het
H2-M5 T A 17: 36,987,431 M331L probably benign Het
Ighv6-6 T A 12: 114,435,217 I10L probably benign Het
Jmy C T 13: 93,442,599 R675Q probably damaging Het
Lonp2 A T 8: 86,665,758 Q484L probably benign Het
Map3k20 T A 2: 72,398,361 L308H probably damaging Het
Mier1 A G 4: 103,139,440 E133G possibly damaging Het
Msh3 C A 13: 92,212,503 V1074L probably benign Het
Muc6 A T 7: 141,639,825 L1645Q unknown Het
Nat10 G A 2: 103,743,090 A354V probably damaging Het
Olfr870 A G 9: 20,171,253 L106P possibly damaging Het
Pdyn A T 2: 129,689,828 V14E possibly damaging Het
Prdm16 T A 4: 154,345,444 H356L probably damaging Het
Rasa3 A G 8: 13,584,961 C453R probably benign Het
Rasgrf2 C T 13: 92,131,406 S30N possibly damaging Het
Rlf A G 4: 121,159,196 S315P probably damaging Het
Rusc2 C T 4: 43,425,335 R1147W possibly damaging Het
Sacs T A 14: 61,202,871 Y789N probably damaging Het
Sap130 T C 18: 31,653,623 L289P probably damaging Het
Sept3 A G 15: 82,290,782 Y308C probably damaging Het
Slc2a12 A G 10: 22,693,994 D528G probably damaging Het
Slc2a13 A G 15: 91,272,156 *638Q probably null Het
Smchd1 T A 17: 71,390,479 E1155D probably benign Het
Sorcs2 G A 5: 36,397,952 R32C probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tonsl C T 15: 76,633,652 D650N probably damaging Het
Tti1 A T 2: 158,009,029 F97I possibly damaging Het
Ttn T C 2: 76,742,210 Q26113R possibly damaging Het
Unc5d A T 8: 28,719,975 N444K probably damaging Het
Usp17la A T 7: 104,861,447 K420* probably null Het
Vmn2r114 T C 17: 23,308,203 N452D possibly damaging Het
Vps16 T C 2: 130,440,528 V427A probably benign Het
Wdr5b T A 16: 36,042,342 V277D probably damaging Het
Zan T A 5: 137,467,108 M462L possibly damaging Het
Zfp40 A G 17: 23,178,283 V80A possibly damaging Het
Zfp930 A T 8: 69,228,685 H344L probably damaging Het
Other mutations in Mep1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Mep1b APN 18 21084186 nonsense probably null
IGL01470:Mep1b APN 18 21097467 missense probably benign 0.26
IGL01866:Mep1b APN 18 21094993 missense probably benign 0.34
IGL02865:Mep1b APN 18 21093384 missense probably benign 0.02
IGL03093:Mep1b APN 18 21093653 missense probably benign 0.01
IGL03126:Mep1b APN 18 21088560 missense probably damaging 1.00
IGL03196:Mep1b APN 18 21095064 missense probably benign 0.01
P0022:Mep1b UTSW 18 21088541 splice site probably benign
R0143:Mep1b UTSW 18 21095107 splice site probably benign
R0743:Mep1b UTSW 18 21080458 missense possibly damaging 0.81
R0961:Mep1b UTSW 18 21088729 nonsense probably null
R1913:Mep1b UTSW 18 21093229 missense probably benign 0.21
R2162:Mep1b UTSW 18 21086239 missense possibly damaging 0.82
R2307:Mep1b UTSW 18 21088575 missense probably damaging 1.00
R3000:Mep1b UTSW 18 21093304 missense probably damaging 0.96
R3833:Mep1b UTSW 18 21086239 missense possibly damaging 0.82
R3862:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R3863:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R3864:Mep1b UTSW 18 21084169 missense possibly damaging 0.56
R4171:Mep1b UTSW 18 21095106 splice site probably null
R4774:Mep1b UTSW 18 21086184 missense probably benign 0.24
R4798:Mep1b UTSW 18 21093254 missense probably damaging 0.99
R5411:Mep1b UTSW 18 21086249 missense probably damaging 1.00
R6952:Mep1b UTSW 18 21088670 missense probably benign 0.00
R7056:Mep1b UTSW 18 21091190 missense probably damaging 1.00
R7078:Mep1b UTSW 18 21100051 missense probably benign 0.35
R7217:Mep1b UTSW 18 21093543 missense probably benign 0.01
R7843:Mep1b UTSW 18 21095053 missense probably damaging 1.00
R7926:Mep1b UTSW 18 21095053 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGGGACTACACCATAG -3'
(R):5'- GCAAGACCACATGCTTCCTG -3'

Sequencing Primer
(F):5'- TGGGACTACACCATAGCTCAATAG -3'
(R):5'- AAGACCACATGCTTCCTGTGTTAG -3'
Posted On2019-10-24