Mutagenetix > Incidental Mutation

Incidental Mutation 'R7641:Dock8'

590273

Institutional Source

Beutler Lab

Gene Symbol

Dock8

Ensembl Gene

ENSMUSG00000052085

Gene Name

dedicator of cytokinesis 8

Synonyms

A130095G14Rik, 5830472H07Rik, 1200017A24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R7641 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24999529-25202432 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 25174333 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000025831 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025831]

AlphaFold

Q8C147

PDB Structure

Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]

Predicted Effect

probably null
Transcript: ENSMUST00000025831

SMART Domains

Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085

Domain	Start	End	E-Value	Type
Pfam:DUF3398	71	164	3.9e-25	PFAM
Pfam:DOCK-C2	557	739	6.7e-49	PFAM
low complexity region	786	803	N/A	INTRINSIC
low complexity region	1003	1020	N/A	INTRINSIC
low complexity region	1123	1138	N/A	INTRINSIC
low complexity region	1236	1246	N/A	INTRINSIC
low complexity region	1371	1383	N/A	INTRINSIC
Pfam:DHR-2	1534	2060	5e-210	PFAM

Meta Mutation Damage Score

0.9592

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam1a	T	A	5: 121,519,307	Q641L	probably benign	Het
Aknad1	A	T	3: 108,771,975	H474L	probably benign	Het
Alkal1	A	T	1: 6,389,488	Y96F	probably damaging	Het
Cars	A	G	7: 143,587,103		probably null	Het
Chtf18	A	T	17: 25,722,275		probably null	Het
Cog2	C	A	8: 124,537,882	N333K	probably damaging	Het
Col6a5	T	A	9: 105,881,426	R2194*	probably null	Het
Dnah14	A	T	1: 181,707,533	I2355L	probably benign	Het
Dpy19l3	A	C	7: 35,695,309	D601E	probably damaging	Het
Elf1	G	A	14: 79,570,723	G205E	probably damaging	Het
Fsip2	A	T	2: 82,986,912	K4330*	probably null	Het
Gm6525	A	T	3: 84,174,843	T24S	probably benign	Het
Golga4	G	T	9: 118,557,575	R1255L	probably benign	Het
Gpn2	A	T	4: 133,588,659	Q243L	probably null	Het
Grb10	T	C	11: 11,933,492	K588E	possibly damaging	Het
Gys1	T	C	7: 45,455,071	S641P	probably damaging	Het
H2-M5	T	A	17: 36,987,431	M331L	probably benign	Het
Ighv6-6	T	A	12: 114,435,217	I10L	probably benign	Het
Jmy	C	T	13: 93,442,599	R675Q	probably damaging	Het
Lonp2	A	T	8: 86,665,758	Q484L	probably benign	Het
Map3k20	T	A	2: 72,398,361	L308H	probably damaging	Het
Mep1b	T	C	18: 21,094,977	F546L	possibly damaging	Het
Mier1	A	G	4: 103,139,440	E133G	possibly damaging	Het
Msh3	C	A	13: 92,212,503	V1074L	probably benign	Het
Muc6	A	T	7: 141,639,825	L1645Q	unknown	Het
Nat10	G	A	2: 103,743,090	A354V	probably damaging	Het
Olfr870	A	G	9: 20,171,253	L106P	possibly damaging	Het
Pdyn	A	T	2: 129,689,828	V14E	possibly damaging	Het
Prdm16	T	A	4: 154,345,444	H356L	probably damaging	Het
Rasa3	A	G	8: 13,584,961	C453R	probably benign	Het
Rasgrf2	C	T	13: 92,131,406	S30N	possibly damaging	Het
Rlf	A	G	4: 121,159,196	S315P	probably damaging	Het
Rusc2	C	T	4: 43,425,335	R1147W	possibly damaging	Het
Sacs	T	A	14: 61,202,871	Y789N	probably damaging	Het
Sap130	T	C	18: 31,653,623	L289P	probably damaging	Het
Sept3	A	G	15: 82,290,782	Y308C	probably damaging	Het
Slc2a12	A	G	10: 22,693,994	D528G	probably damaging	Het
Slc2a13	A	G	15: 91,272,156	*638Q	probably null	Het
Smchd1	T	A	17: 71,390,479	E1155D	probably benign	Het
Sorcs2	G	A	5: 36,397,952	R32C	probably damaging	Het
Sp110	G	A	1: 85,579,092	R417C	probably benign	Het
Tonsl	C	T	15: 76,633,652	D650N	probably damaging	Het
Tti1	A	T	2: 158,009,029	F97I	possibly damaging	Het
Ttn	T	C	2: 76,742,210	Q26113R	possibly damaging	Het
Unc5d	A	T	8: 28,719,975	N444K	probably damaging	Het
Usp17la	A	T	7: 104,861,447	K420*	probably null	Het
Vmn2r114	T	C	17: 23,308,203	N452D	possibly damaging	Het
Vps16	T	C	2: 130,440,528	V427A	probably benign	Het
Wdr5b	T	A	16: 36,042,342	V277D	probably damaging	Het
Zan	T	A	5: 137,467,108	M462L	possibly damaging	Het
Zfp40	A	G	17: 23,178,283	V80A	possibly damaging	Het
Zfp930	A	T	8: 69,228,685	H344L	probably damaging	Het

Other mutations in Dock8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
captain_morgan	APN	19	25127711	critical splice donor site	probably benign
primurus	APN	19	25183609	missense	probably damaging	1.00
IGL00737:Dock8	APN	19	25182976	missense	probably benign	0.00
IGL00755:Dock8	APN	19	25051509	missense	probably benign	0.09
IGL00822:Dock8	APN	19	25188409	nonsense	probably null
IGL00838:Dock8	APN	19	25175459	nonsense	probably null
IGL01419:Dock8	APN	19	25119452	missense	probably benign	0.08
IGL01456:Dock8	APN	19	25119499	missense	possibly damaging	0.95
IGL01532:Dock8	APN	19	25169441	missense	probably damaging	0.99
IGL01602:Dock8	APN	19	25089888	splice site	probably benign
IGL01605:Dock8	APN	19	25089888	splice site	probably benign
IGL01753:Dock8	APN	19	25061292	splice site	probably benign
IGL01843:Dock8	APN	19	25089928	missense	probably benign	0.02
IGL02032:Dock8	APN	19	25130405	missense	probably damaging	0.99
IGL02073:Dock8	APN	19	25200986	critical splice acceptor site	probably null
IGL02192:Dock8	APN	19	25078205	critical splice donor site	probably null
IGL02402:Dock8	APN	19	25078145	missense	probably benign	0.25
IGL02529:Dock8	APN	19	25100926	nonsense	probably null
IGL02728:Dock8	APN	19	25132220	missense	probably benign
IGL02739:Dock8	APN	19	25188488	missense	probably damaging	1.00
IGL03037:Dock8	APN	19	25086181	missense	probably benign	0.02
IGL03104:Dock8	APN	19	25201020	nonsense	probably null
IGL03137:Dock8	APN	19	25155948	missense	probably benign	0.19
IGL03365:Dock8	APN	19	25099684	missense	possibly damaging	0.70
Defenseless	UTSW	19	25051563	missense	probably benign	0.00
Guardate	UTSW	19	25149831	missense	probably benign
hillock	UTSW	19	25174333	critical splice donor site	probably null
Molehill	UTSW	19	25130461	missense	probably damaging	1.00
Pap	UTSW	19	25122441	missense	probably benign	0.31
Papilla	UTSW	19	25078084	nonsense	probably null
snowdrop	UTSW	19	25184941	critical splice donor site	probably null
warts_and_all	UTSW	19	25169501	critical splice donor site	probably null
R0021:Dock8	UTSW	19	25163047	missense	probably benign	0.01
R0147:Dock8	UTSW	19	25119459	missense	probably benign	0.00
R0148:Dock8	UTSW	19	25119459	missense	probably benign	0.00
R0294:Dock8	UTSW	19	25188350	missense	probably damaging	1.00
R0537:Dock8	UTSW	19	25171577	missense	probably benign	0.08
R0630:Dock8	UTSW	19	25061160	missense	probably benign	0.10
R1163:Dock8	UTSW	19	25051503	missense	probably benign
R1164:Dock8	UTSW	19	25090027	missense	probably benign	0.44
R1471:Dock8	UTSW	19	25201036	missense	possibly damaging	0.74
R1477:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R1633:Dock8	UTSW	19	25051563	missense	probably benign	0.00
R1803:Dock8	UTSW	19	25132235	missense	probably benign	0.00
R1822:Dock8	UTSW	19	25161058	missense	probably benign	0.31
R1852:Dock8	UTSW	19	25127128	missense	probably benign	0.45
R1916:Dock8	UTSW	19	25061157	missense	probably benign	0.02
R1984:Dock8	UTSW	19	25121181	missense	probably null
R2311:Dock8	UTSW	19	25183004	missense	possibly damaging	0.93
R2341:Dock8	UTSW	19	25200393	missense	probably damaging	0.99
R2483:Dock8	UTSW	19	25079877	missense	probably benign
R3116:Dock8	UTSW	19	25188494	missense	probably benign	0.00
R3157:Dock8	UTSW	19	25149831	missense	probably benign
R3623:Dock8	UTSW	19	25079877	missense	probably benign
R3624:Dock8	UTSW	19	25079877	missense	probably benign
R3800:Dock8	UTSW	19	25164352	missense	probably benign	0.08
R3844:Dock8	UTSW	19	25065430	nonsense	probably null
R3895:Dock8	UTSW	19	25051501	missense	probably benign	0.31
R3901:Dock8	UTSW	19	25100905	missense	possibly damaging	0.69
R3959:Dock8	UTSW	19	25184941	critical splice donor site	probably null
R4428:Dock8	UTSW	19	25200499	missense	probably damaging	0.98
R4428:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4429:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4431:Dock8	UTSW	19	25065390	missense	probably benign	0.00
R4545:Dock8	UTSW	19	25188358	missense	probably damaging	1.00
R4839:Dock8	UTSW	19	25169494	missense	probably benign	0.00
R4897:Dock8	UTSW	19	25181637	missense	probably benign	0.00
R4939:Dock8	UTSW	19	25122400	missense	probably damaging	1.00
R4995:Dock8	UTSW	19	25158383	missense	probably benign	0.02
R5035:Dock8	UTSW	19	25086207	missense	probably damaging	0.99
R5294:Dock8	UTSW	19	25061153	missense	probably benign	0.01
R5324:Dock8	UTSW	19	25163094	missense	probably benign	0.17
R5478:Dock8	UTSW	19	25079822	missense	probably benign
R5704:Dock8	UTSW	19	25174222	missense	probably damaging	1.00
R5724:Dock8	UTSW	19	25122421	missense	probably damaging	1.00
R5745:Dock8	UTSW	19	25130397	missense	probably benign	0.02
R5864:Dock8	UTSW	19	25061220	missense	probably damaging	0.99
R5870:Dock8	UTSW	19	25132126	missense	probably benign
R5893:Dock8	UTSW	19	25122447	missense	probably damaging	1.00
R5954:Dock8	UTSW	19	25171619	missense	probably damaging	1.00
R6087:Dock8	UTSW	19	25161074	missense	probably benign	0.00
R6223:Dock8	UTSW	19	25161052	missense	probably benign	0.00
R6391:Dock8	UTSW	19	25095550	missense	possibly damaging	0.95
R6759:Dock8	UTSW	19	25127484	missense	probably damaging	0.99
R6786:Dock8	UTSW	19	25183022	missense	possibly damaging	0.49
R6794:Dock8	UTSW	19	25122441	missense	probably benign	0.31
R6818:Dock8	UTSW	19	25169501	critical splice donor site	probably null
R6885:Dock8	UTSW	19	25147378	missense	possibly damaging	0.95
R6908:Dock8	UTSW	19	25188382	missense	probably damaging	1.00
R6923:Dock8	UTSW	19	25095606	missense	probably benign
R7001:Dock8	UTSW	19	25099677	missense	probably benign
R7141:Dock8	UTSW	19	25181620	missense	probably null	0.75
R7203:Dock8	UTSW	19	25181563	missense	probably damaging	1.00
R7257:Dock8	UTSW	19	25127085	missense	probably benign	0.08
R7296:Dock8	UTSW	19	25184881	missense	probably benign	0.00
R7538:Dock8	UTSW	19	25158418	missense	probably damaging	1.00
R7555:Dock8	UTSW	19	25175400	missense	probably damaging	0.99
R7764:Dock8	UTSW	19	25097535	missense	probably benign
R7859:Dock8	UTSW	19	25183570	missense	probably damaging	1.00
R7864:Dock8	UTSW	19	25163500	missense	possibly damaging	0.95
R8090:Dock8	UTSW	19	25154242	missense	probably damaging	1.00
R8160:Dock8	UTSW	19	25147347	missense	probably damaging	1.00
R8287:Dock8	UTSW	19	25130461	missense	probably damaging	1.00
R8295:Dock8	UTSW	19	25123236	missense	probably benign	0.04
R8443:Dock8	UTSW	19	25155917	missense	probably benign	0.04
R8537:Dock8	UTSW	19	25130506	missense	probably benign	0.00
R8673:Dock8	UTSW	19	25183503	missense	probably damaging	0.96
R8709:Dock8	UTSW	19	25078084	nonsense	probably null
R8834:Dock8	UTSW	19	25163470	missense	probably benign	0.16
R8991:Dock8	UTSW	19	25188367	missense	possibly damaging	0.82
R9292:Dock8	UTSW	19	25183631	splice site	probably benign
R9509:Dock8	UTSW	19	25095621	missense	probably benign	0.00
R9526:Dock8	UTSW	19	25188375	missense	probably benign	0.10
R9622:Dock8	UTSW	19	25121181	missense	probably null
R9634:Dock8	UTSW	19	25192221	missense	probably damaging	1.00
R9654:Dock8	UTSW	19	25147346	missense	probably damaging	1.00
R9670:Dock8	UTSW	19	25171562	missense	probably null	0.01
R9699:Dock8	UTSW	19	25156024	critical splice donor site	probably null
R9726:Dock8	UTSW	19	25177010	missense	probably damaging	0.97
R9765:Dock8	UTSW	19	25169468	missense	possibly damaging	0.94
X0027:Dock8	UTSW	19	25161129	missense	probably benign
Z1177:Dock8	UTSW	19	25132123	missense	probably benign	0.05
Z1177:Dock8	UTSW	19	25155972	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GGTACCTGCTGACTCTCGTTTG -3'
(R):5'- GCCATCTTGAAGTTGAGGACAG -3'

Sequencing Primer
(F):5'- GCTCCATCTCTTCTGATGCAGAAC -3'
(R):5'- GTGTGTGTATTGCATTTCTCAAGCAC -3'

Posted On

2019-10-24