Incidental Mutation 'R7642:Cfap57'
ID 590287
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Name cilia and flagella associated protein 57
Synonyms Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7642 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 118554551-118620777 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 118614931 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 84 (V84I)
Ref Sequence ENSEMBL: ENSMUSP00000071863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
AlphaFold Q9D180
Predicted Effect probably benign
Transcript: ENSMUST00000071972
AA Change: V84I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: V84I

Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081921
AA Change: V84I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: V84I

Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,477,032 S680P probably benign Het
Carmil1 T C 13: 24,067,206 T844A probably benign Het
Clca4a A T 3: 144,953,751 D781E probably benign Het
Col10a1 A G 10: 34,395,642 M537V probably benign Het
Col5a2 A G 1: 45,376,088 M1497T probably benign Het
Csmd1 T A 8: 16,085,178 I1655F probably damaging Het
Cts3 A G 13: 61,568,775 S16P probably benign Het
Cyp2c67 T C 19: 39,615,640 Y424C probably damaging Het
Dip2c T C 13: 9,622,705 probably null Het
Dnah5 T C 15: 28,247,979 probably null Het
Dpp4 A G 2: 62,360,283 probably null Het
Fam135b T G 15: 71,479,142 N295T possibly damaging Het
Fign A G 2: 63,980,572 V118A probably benign Het
Gpr108 A T 17: 57,236,228 Y480* probably null Het
Ky T C 9: 102,542,270 V492A probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc30 C T 17: 67,632,477 G36E probably damaging Het
Map2 T C 1: 66,413,307 V452A probably benign Het
Mks1 C T 11: 87,856,840 T183M possibly damaging Het
Mpg G A 11: 32,229,517 probably null Het
Nat10 A G 2: 103,726,786 L841P possibly damaging Het
Nbeal1 A G 1: 60,277,227 E1863G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nr2e3 T A 9: 59,947,388 I292F possibly damaging Het
Nxn T C 11: 76,272,459 Y246C probably damaging Het
Olfr1048 A T 2: 86,236,316 L166* probably null Het
Olfr1289 T C 2: 111,483,478 F44S probably damaging Het
Olfr194 T G 16: 59,119,648 T141P possibly damaging Het
Olfr196 A G 16: 59,167,717 V142A probably benign Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Pcdha5 T A 18: 36,960,491 F18I probably benign Het
Pcdhb17 A G 18: 37,485,726 K190E probably damaging Het
Ppm1g G T 5: 31,205,103 Y284* probably null Het
Rp1 A G 1: 4,147,831 V1026A unknown Het
Scap C T 9: 110,374,013 R252C probably damaging Het
Scn9a C A 2: 66,536,236 K734N probably benign Het
Sema5a C T 15: 32,682,325 S955F probably damaging Het
Serpinb10 A G 1: 107,529,101 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sh2d5 A G 4: 138,259,156 T397A probably benign Het
Slc22a8 T C 19: 8,610,045 F490L probably benign Het
Tbc1d19 A T 5: 53,856,918 Y296F probably damaging Het
Tmppe T C 9: 114,404,794 S54P possibly damaging Het
Vmn1r123 A T 7: 21,162,870 N229I probably benign Het
Wdr36 T A 18: 32,854,571 probably null Het
Wdr47 T A 3: 108,643,164 M835K possibly damaging Het
Wscd2 A T 5: 113,577,414 K438N possibly damaging Het
Xrcc6 T A 15: 82,016,477 probably null Het
Xrn1 T A 9: 96,021,853 F1148I possibly damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
G1Funyon:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1217:Cfap57 UTSW 4 118606652 missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R1487:Cfap57 UTSW 4 118614781 missense probably benign 0.01
R1676:Cfap57 UTSW 4 118595940 missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1709:Cfap57 UTSW 4 118571704 missense probably benign 0.00
R1719:Cfap57 UTSW 4 118606631 missense probably benign 0.04
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118599894 missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118593132 missense probably benign 0.03
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118569459 missense probably benign
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118571745 missense probably benign 0.00
R6244:Cfap57 UTSW 4 118579410 missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118613126 missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118620709 unclassified probably benign
R7162:Cfap57 UTSW 4 118614931 missense probably benign
R7174:Cfap57 UTSW 4 118589067 missense probably benign 0.35
R7210:Cfap57 UTSW 4 118576703 nonsense probably null
R7242:Cfap57 UTSW 4 118593096 missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118554800 nonsense probably null
R7359:Cfap57 UTSW 4 118598965 missense probably benign 0.01
R7373:Cfap57 UTSW 4 118614931 missense probably benign
R7394:Cfap57 UTSW 4 118593137 missense probably benign 0.00
R7401:Cfap57 UTSW 4 118614931 missense probably benign
R7412:Cfap57 UTSW 4 118614931 missense probably benign
R7414:Cfap57 UTSW 4 118614931 missense probably benign
R7452:Cfap57 UTSW 4 118595784 missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118589001 missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118614931 missense probably benign
R7741:Cfap57 UTSW 4 118614931 missense probably benign
R7744:Cfap57 UTSW 4 118614931 missense probably benign
R7745:Cfap57 UTSW 4 118614931 missense probably benign
R7842:Cfap57 UTSW 4 118554755 nonsense probably null
R7936:Cfap57 UTSW 4 118614931 missense probably benign
R7940:Cfap57 UTSW 4 118614931 missense probably benign
R7942:Cfap57 UTSW 4 118614931 missense probably benign
R8074:Cfap57 UTSW 4 118569625 missense possibly damaging 0.66
R8301:Cfap57 UTSW 4 118593074 missense possibly damaging 0.94
R8411:Cfap57 UTSW 4 118614931 missense probably benign
R8447:Cfap57 UTSW 4 118614931 missense probably benign
R8491:Cfap57 UTSW 4 118614931 missense probably benign
R8524:Cfap57 UTSW 4 118614931 missense probably benign
R8670:Cfap57 UTSW 4 118614925 missense possibly damaging 0.91
R8707:Cfap57 UTSW 4 118593006 missense probably benign 0.04
R8790:Cfap57 UTSW 4 118581914 missense possibly damaging 0.59
R8941:Cfap57 UTSW 4 118569602 missense probably damaging 0.99
R9139:Cfap57 UTSW 4 118554851 missense probably benign 0.02
R9212:Cfap57 UTSW 4 118579452 missense possibly damaging 0.95
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Z1177:Cfap57 UTSW 4 118598956 critical splice donor site probably null
Predicted Primers
Posted On 2019-10-24