Incidental Mutation 'R7642:Mks1'
ID590303
Institutional Source Beutler Lab
Gene Symbol Mks1
Ensembl Gene ENSMUSG00000034121
Gene NameMeckel syndrome, type 1
SynonymsB8d3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7642 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location87853215-87863803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87856840 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 183 (T183M)
Ref Sequence ENSEMBL: ENSMUSP00000043790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038196]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038196
AA Change: T183M

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043790
Gene: ENSMUSG00000034121
AA Change: T183M

DomainStartEndE-ValueType
low complexity region 163 170 N/A INTRINSIC
Pfam:B9-C2 316 496 1.8e-45 PFAM
low complexity region 533 547 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the basal body and is required for formation of the primary cilium in ciliated epithelial cells. Mutations in this gene result in Meckel syndrome type 1 and in Bardet-Biedl syndrome type 13. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit polydactyly, heterotaxia, skeletal defects, and kidney cysts along with abnormal lung, kidney, liver, and heart morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,477,032 S680P probably benign Het
Carmil1 T C 13: 24,067,206 T844A probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Clca4a A T 3: 144,953,751 D781E probably benign Het
Col10a1 A G 10: 34,395,642 M537V probably benign Het
Col5a2 A G 1: 45,376,088 M1497T probably benign Het
Csmd1 T A 8: 16,085,178 I1655F probably damaging Het
Cts3 A G 13: 61,568,775 S16P probably benign Het
Cyp2c67 T C 19: 39,615,640 Y424C probably damaging Het
Dip2c T C 13: 9,622,705 probably null Het
Dnah5 T C 15: 28,247,979 probably null Het
Dpp4 A G 2: 62,360,283 probably null Het
Fam135b T G 15: 71,479,142 N295T possibly damaging Het
Fign A G 2: 63,980,572 V118A probably benign Het
Gpr108 A T 17: 57,236,228 Y480* probably null Het
Ky T C 9: 102,542,270 V492A probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc30 C T 17: 67,632,477 G36E probably damaging Het
Map2 T C 1: 66,413,307 V452A probably benign Het
Mpg G A 11: 32,229,517 probably null Het
Nat10 A G 2: 103,726,786 L841P possibly damaging Het
Nbeal1 A G 1: 60,277,227 E1863G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nr2e3 T A 9: 59,947,388 I292F possibly damaging Het
Nxn T C 11: 76,272,459 Y246C probably damaging Het
Olfr1048 A T 2: 86,236,316 L166* probably null Het
Olfr1289 T C 2: 111,483,478 F44S probably damaging Het
Olfr194 T G 16: 59,119,648 T141P possibly damaging Het
Olfr196 A G 16: 59,167,717 V142A probably benign Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Pcdha5 T A 18: 36,960,491 F18I probably benign Het
Pcdhb17 A G 18: 37,485,726 K190E probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Ppm1g G T 5: 31,205,103 Y284* probably null Het
Rp1 A G 1: 4,147,831 V1026A unknown Het
Scap C T 9: 110,374,013 R252C probably damaging Het
Scn9a C A 2: 66,536,236 K734N probably benign Het
Sema5a C T 15: 32,682,325 S955F probably damaging Het
Serpinb10 A G 1: 107,529,101 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sh2d5 A G 4: 138,259,156 T397A probably benign Het
Slc22a8 T C 19: 8,610,045 F490L probably benign Het
Tbc1d19 A T 5: 53,856,918 Y296F probably damaging Het
Tmppe T C 9: 114,404,794 S54P possibly damaging Het
Vmn1r123 A T 7: 21,162,870 N229I probably benign Het
Wdr36 T A 18: 32,854,571 probably null Het
Wdr47 T A 3: 108,643,164 M835K possibly damaging Het
Wscd2 A T 5: 113,577,414 K438N possibly damaging Het
Xrcc6 T A 15: 82,016,477 probably null Het
Xrn1 T A 9: 96,021,853 F1148I possibly damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Mks1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01799:Mks1 APN 11 87856863 missense probably benign 0.28
IGL02291:Mks1 APN 11 87859667 unclassified probably benign
IGL02406:Mks1 APN 11 87862785 missense probably benign 0.02
IGL02938:Mks1 APN 11 87862652 critical splice donor site probably null
IGL03094:Mks1 APN 11 87855465 splice site probably benign
R0389:Mks1 UTSW 11 87857928 missense probably benign
R0893:Mks1 UTSW 11 87856951 splice site probably benign
R1490:Mks1 UTSW 11 87862769 missense probably benign 0.02
R1514:Mks1 UTSW 11 87861111 missense probably benign 0.31
R2042:Mks1 UTSW 11 87856668 splice site probably benign
R4289:Mks1 UTSW 11 87856704 intron probably benign
R4757:Mks1 UTSW 11 87863024 makesense probably null
R4868:Mks1 UTSW 11 87853723 splice site probably benign
R5243:Mks1 UTSW 11 87856678 intron probably benign
R5708:Mks1 UTSW 11 87856839 missense probably benign 0.21
R5848:Mks1 UTSW 11 87856870 missense probably benign 0.00
R6289:Mks1 UTSW 11 87859659 critical splice donor site probably null
R6320:Mks1 UTSW 11 87855499 missense probably benign 0.00
R7205:Mks1 UTSW 11 87856602 missense probably benign 0.02
R7816:Mks1 UTSW 11 87860716 missense probably damaging 1.00
Z1177:Mks1 UTSW 11 87860723 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTGAGTACAAGCAGCGATCAG -3'
(R):5'- AAGAATCTTCATGGTGGCGC -3'

Sequencing Primer
(F):5'- AGCGATCAGGTGGTCTCC -3'
(R):5'- CATCCCATAGGGCTGTAACAGG -3'
Posted On2019-10-24