Incidental Mutation 'R7642:Dip2c'
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.613) question?
Stock #R7642 (G1)
Quality Score225.009
Status Validated
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 9622705 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably null
Transcript: ENSMUST00000166299
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264

DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169960
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264

DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174552
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264

DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000222280
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,477,032 S680P probably benign Het
Carmil1 T C 13: 24,067,206 T844A probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Clca4a A T 3: 144,953,751 D781E probably benign Het
Col10a1 A G 10: 34,395,642 M537V probably benign Het
Col5a2 A G 1: 45,376,088 M1497T probably benign Het
Csmd1 T A 8: 16,085,178 I1655F probably damaging Het
Cts3 A G 13: 61,568,775 S16P probably benign Het
Cyp2c67 T C 19: 39,615,640 Y424C probably damaging Het
Dnah5 T C 15: 28,247,979 probably null Het
Dpp4 A G 2: 62,360,283 probably null Het
Fam135b T G 15: 71,479,142 N295T possibly damaging Het
Fign A G 2: 63,980,572 V118A probably benign Het
Gpr108 A T 17: 57,236,228 Y480* probably null Het
Ky T C 9: 102,542,270 V492A probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc30 C T 17: 67,632,477 G36E probably damaging Het
Map2 T C 1: 66,413,307 V452A probably benign Het
Mks1 C T 11: 87,856,840 T183M possibly damaging Het
Mpg G A 11: 32,229,517 probably null Het
Nat10 A G 2: 103,726,786 L841P possibly damaging Het
Nbeal1 A G 1: 60,277,227 E1863G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nr2e3 T A 9: 59,947,388 I292F possibly damaging Het
Nxn T C 11: 76,272,459 Y246C probably damaging Het
Olfr1048 A T 2: 86,236,316 L166* probably null Het
Olfr1289 T C 2: 111,483,478 F44S probably damaging Het
Olfr194 T G 16: 59,119,648 T141P possibly damaging Het
Olfr196 A G 16: 59,167,717 V142A probably benign Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Pcdha5 T A 18: 36,960,491 F18I probably benign Het
Pcdhb17 A G 18: 37,485,726 K190E probably damaging Het
Ppm1g G T 5: 31,205,103 Y284* probably null Het
Rp1 A G 1: 4,147,831 V1026A unknown Het
Scap C T 9: 110,374,013 R252C probably damaging Het
Scn9a C A 2: 66,536,236 K734N probably benign Het
Sema5a C T 15: 32,682,325 S955F probably damaging Het
Serpinb10 A G 1: 107,529,101 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sh2d5 A G 4: 138,259,156 T397A probably benign Het
Slc22a8 T C 19: 8,610,045 F490L probably benign Het
Tbc1d19 A T 5: 53,856,918 Y296F probably damaging Het
Tmppe T C 9: 114,404,794 S54P possibly damaging Het
Vmn1r123 A T 7: 21,162,870 N229I probably benign Het
Wdr36 T A 18: 32,854,571 probably null Het
Wdr47 T A 3: 108,643,164 M835K possibly damaging Het
Wscd2 A T 5: 113,577,414 K438N possibly damaging Het
Xrcc6 T A 15: 82,016,477 probably null Het
Xrn1 T A 9: 96,021,853 F1148I possibly damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7371:Dip2c UTSW 13 9592749 missense probably benign 0.02
R7395:Dip2c UTSW 13 9614377 missense probably damaging 1.00
R7489:Dip2c UTSW 13 9533312 missense probably damaging 0.99
R7575:Dip2c UTSW 13 9628012 missense probably damaging 0.97
R7687:Dip2c UTSW 13 9604581 missense probably benign 0.00
R7699:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7700:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7715:Dip2c UTSW 13 9614391 missense probably damaging 1.00
R7842:Dip2c UTSW 13 9606533 critical splice donor site probably null
R7845:Dip2c UTSW 13 9609044 missense probably damaging 1.00
R8354:Dip2c UTSW 13 9621882 missense probably benign 0.05
R8685:Dip2c UTSW 13 9637125 missense probably benign 0.01
R8779:Dip2c UTSW 13 9610809 missense probably damaging 0.98
R8786:Dip2c UTSW 13 9615794 missense probably damaging 0.99
R8815:Dip2c UTSW 13 9623798 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-10-24