Incidental Mutation 'R7642:Olfr98'
ID590316
Institutional Source Beutler Lab
Gene Symbol Olfr98
Ensembl Gene ENSMUSG00000063660
Gene Nameolfactory receptor 98
SynonymsGA_x6K02T2PSCP-1703582-1702653, MOR156-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7642 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location37262711-37263749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37263073 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 197 (M197K)
Ref Sequence ENSEMBL: ENSMUSP00000094936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080759]
Predicted Effect probably benign
Transcript: ENSMUST00000080759
AA Change: M197K

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000094936
Gene: ENSMUSG00000063660
AA Change: M197K

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 9.2e-53 PFAM
Pfam:7TM_GPCR_Srsx 32 302 1.9e-5 PFAM
Pfam:7tm_1 38 287 2.4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174168
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,477,032 S680P probably benign Het
Carmil1 T C 13: 24,067,206 T844A probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Clca4a A T 3: 144,953,751 D781E probably benign Het
Col10a1 A G 10: 34,395,642 M537V probably benign Het
Col5a2 A G 1: 45,376,088 M1497T probably benign Het
Csmd1 T A 8: 16,085,178 I1655F probably damaging Het
Cts3 A G 13: 61,568,775 S16P probably benign Het
Cyp2c67 T C 19: 39,615,640 Y424C probably damaging Het
Dip2c T C 13: 9,622,705 probably null Het
Dnah5 T C 15: 28,247,979 probably null Het
Dpp4 A G 2: 62,360,283 probably null Het
Fam135b T G 15: 71,479,142 N295T possibly damaging Het
Fign A G 2: 63,980,572 V118A probably benign Het
Gpr108 A T 17: 57,236,228 Y480* probably null Het
Ky T C 9: 102,542,270 V492A probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc30 C T 17: 67,632,477 G36E probably damaging Het
Map2 T C 1: 66,413,307 V452A probably benign Het
Mks1 C T 11: 87,856,840 T183M possibly damaging Het
Mpg G A 11: 32,229,517 probably null Het
Nat10 A G 2: 103,726,786 L841P possibly damaging Het
Nbeal1 A G 1: 60,277,227 E1863G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nr2e3 T A 9: 59,947,388 I292F possibly damaging Het
Nxn T C 11: 76,272,459 Y246C probably damaging Het
Olfr1048 A T 2: 86,236,316 L166* probably null Het
Olfr1289 T C 2: 111,483,478 F44S probably damaging Het
Olfr194 T G 16: 59,119,648 T141P possibly damaging Het
Olfr196 A G 16: 59,167,717 V142A probably benign Het
Pcdha5 T A 18: 36,960,491 F18I probably benign Het
Pcdhb17 A G 18: 37,485,726 K190E probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Ppm1g G T 5: 31,205,103 Y284* probably null Het
Rp1 A G 1: 4,147,831 V1026A unknown Het
Scap C T 9: 110,374,013 R252C probably damaging Het
Scn9a C A 2: 66,536,236 K734N probably benign Het
Sema5a C T 15: 32,682,325 S955F probably damaging Het
Serpinb10 A G 1: 107,529,101 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sh2d5 A G 4: 138,259,156 T397A probably benign Het
Slc22a8 T C 19: 8,610,045 F490L probably benign Het
Tbc1d19 A T 5: 53,856,918 Y296F probably damaging Het
Tmppe T C 9: 114,404,794 S54P possibly damaging Het
Vmn1r123 A T 7: 21,162,870 N229I probably benign Het
Wdr36 T A 18: 32,854,571 probably null Het
Wdr47 T A 3: 108,643,164 M835K possibly damaging Het
Wscd2 A T 5: 113,577,414 K438N possibly damaging Het
Xrcc6 T A 15: 82,016,477 probably null Het
Xrn1 T A 9: 96,021,853 F1148I possibly damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Olfr98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02402:Olfr98 APN 17 37263220 missense possibly damaging 0.46
PIT4495001:Olfr98 UTSW 17 37262830 missense possibly damaging 0.88
R0574:Olfr98 UTSW 17 37262881 missense probably damaging 1.00
R1490:Olfr98 UTSW 17 37262842 missense probably benign 0.00
R1633:Olfr98 UTSW 17 37263662 start codon destroyed probably benign 0.02
R2105:Olfr98 UTSW 17 37263073 missense probably benign 0.26
R4996:Olfr98 UTSW 17 37262867 missense probably benign 0.02
R5114:Olfr98 UTSW 17 37262839 missense probably damaging 1.00
R5225:Olfr98 UTSW 17 37263028 missense probably benign 0.30
R5338:Olfr98 UTSW 17 37263641 missense probably benign 0.00
R5995:Olfr98 UTSW 17 37263648 missense probably benign 0.01
R6190:Olfr98 UTSW 17 37262744 missense probably benign 0.00
R7006:Olfr98 UTSW 17 37262734 makesense probably null
R7246:Olfr98 UTSW 17 37263014 missense probably benign 0.00
R7261:Olfr98 UTSW 17 37263185 missense probably benign
R7611:Olfr98 UTSW 17 37262854 missense probably benign 0.02
R8837:Olfr98 UTSW 17 37262916 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAGGTAGCAAAGACTGTGCTGTAG -3'
(R):5'- GCTATGCTGCTATCTGCCAC -3'

Sequencing Primer
(F):5'- CTGTGCTGTAGAAAAGGAGGACTAC -3'
(R):5'- ATGACTCCTTGTAGATGTAGAGTTC -3'
Posted On2019-10-24