Incidental Mutation 'R7642:Cyp2c67'
ID590322
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 67
SynonymsC730004C24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7642 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location39608842-39649051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39615640 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 424 (Y424C)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
Predicted Effect probably damaging
Transcript: ENSMUST00000067328
AA Change: Y424C

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: Y424C

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b1 T C 13: 94,477,032 S680P probably benign Het
Carmil1 T C 13: 24,067,206 T844A probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Clca4a A T 3: 144,953,751 D781E probably benign Het
Col10a1 A G 10: 34,395,642 M537V probably benign Het
Col5a2 A G 1: 45,376,088 M1497T probably benign Het
Csmd1 T A 8: 16,085,178 I1655F probably damaging Het
Cts3 A G 13: 61,568,775 S16P probably benign Het
Dip2c T C 13: 9,622,705 probably null Het
Dnah5 T C 15: 28,247,979 probably null Het
Dpp4 A G 2: 62,360,283 probably null Het
Fam135b T G 15: 71,479,142 N295T possibly damaging Het
Fign A G 2: 63,980,572 V118A probably benign Het
Gpr108 A T 17: 57,236,228 Y480* probably null Het
Ky T C 9: 102,542,270 V492A probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrrc30 C T 17: 67,632,477 G36E probably damaging Het
Map2 T C 1: 66,413,307 V452A probably benign Het
Mks1 C T 11: 87,856,840 T183M possibly damaging Het
Mpg G A 11: 32,229,517 probably null Het
Nat10 A G 2: 103,726,786 L841P possibly damaging Het
Nbeal1 A G 1: 60,277,227 E1863G probably benign Het
Neurl1b C G 17: 26,438,746 H219Q probably benign Het
Nr2e3 T A 9: 59,947,388 I292F possibly damaging Het
Nxn T C 11: 76,272,459 Y246C probably damaging Het
Olfr1048 A T 2: 86,236,316 L166* probably null Het
Olfr1289 T C 2: 111,483,478 F44S probably damaging Het
Olfr194 T G 16: 59,119,648 T141P possibly damaging Het
Olfr196 A G 16: 59,167,717 V142A probably benign Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Pcdha5 T A 18: 36,960,491 F18I probably benign Het
Pcdhb17 A G 18: 37,485,726 K190E probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Ppm1g G T 5: 31,205,103 Y284* probably null Het
Rp1 A G 1: 4,147,831 V1026A unknown Het
Scap C T 9: 110,374,013 R252C probably damaging Het
Scn9a C A 2: 66,536,236 K734N probably benign Het
Sema5a C T 15: 32,682,325 S955F probably damaging Het
Serpinb10 A G 1: 107,529,101 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sh2d5 A G 4: 138,259,156 T397A probably benign Het
Slc22a8 T C 19: 8,610,045 F490L probably benign Het
Tbc1d19 A T 5: 53,856,918 Y296F probably damaging Het
Tmppe T C 9: 114,404,794 S54P possibly damaging Het
Vmn1r123 A T 7: 21,162,870 N229I probably benign Het
Wdr36 T A 18: 32,854,571 probably null Het
Wdr47 T A 3: 108,643,164 M835K possibly damaging Het
Wscd2 A T 5: 113,577,414 K438N possibly damaging Het
Xrcc6 T A 15: 82,016,477 probably null Het
Xrn1 T A 9: 96,021,853 F1148I possibly damaging Het
Zmynd8 T C 2: 165,812,426 D722G probably damaging Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39643385 missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39639932 nonsense probably null
IGL01363:Cyp2c67 APN 19 39639967 missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39615721 missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39649026 missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39649002 missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02355:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02358:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02362:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02388:Cyp2c67 APN 19 39643355 missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39643675 missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39643294 missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39643269 critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39643684 missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39639961 missense probably damaging 1.00
IGL03052:Cyp2c67 UTSW 19 39648885 missense possibly damaging 0.88
R0585:Cyp2c67 UTSW 19 39638694 missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39609178 missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39643374 missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39626141 missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39638625 missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39638591 missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39648964 missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1613:Cyp2c67 UTSW 19 39626199 missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1667:Cyp2c67 UTSW 19 39643590 critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39617367 missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39643345 missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39626237 missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39609097 missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39638683 missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39643654 missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39638588 missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39643744 missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39615724 missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39638688 missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39626232 missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39615650 missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39615694 missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39617435 missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39617429 missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39617410 nonsense probably null
R6939:Cyp2c67 UTSW 19 39643334 missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39615679 missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39639897 missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39615694 missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39617339 missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39640007 nonsense probably null
R7337:Cyp2c67 UTSW 19 39609264 splice site probably null
R7474:Cyp2c67 UTSW 19 39617432 missense probably null 0.05
R7870:Cyp2c67 UTSW 19 39609225 missense probably damaging 1.00
R8152:Cyp2c67 UTSW 19 39640008 missense probably benign 0.21
R8367:Cyp2c67 UTSW 19 39638674 missense probably benign 0.01
Z1177:Cyp2c67 UTSW 19 39643679 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGCATGAACACAGTGAATCC -3'
(R):5'- GGAGAACAATGTTCAGCACCC -3'

Sequencing Primer
(F):5'- TCTGGCAAGAAAATGTGTCATCG -3'
(R):5'- GCACCCTGAGACATTCATACATTG -3'
Posted On2019-10-24