Incidental Mutation 'R7643:Cfhr1'
ID590327
Institutional Source Beutler Lab
Gene Symbol Cfhr1
Ensembl Gene ENSMUSG00000057037
Gene Namecomplement factor H-related 1
SynonymsCfhl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7643 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location139547053-139560272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139553585 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 186 (Y186H)
Ref Sequence ENSEMBL: ENSMUSP00000023965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023965]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023965
AA Change: Y186H

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023965
Gene: ENSMUSG00000057037
AA Change: Y186H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CCP 28 88 1.12e-4 SMART
CCP 92 145 3.48e-10 SMART
CCP 154 208 4.95e-15 SMART
CCP 215 269 3.5e-15 SMART
CCP 273 334 1.04e1 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein belonging to the complement factor H protein family. It binds to Pseudomonas aeruginosa elongation factor Tuf together with plasminogen, which is proteolytically activated. It is proposed that Tuf acts as a virulence factor by acquiring host proteins to the pathogen surface, controlling complement, and facilitating tissue invasion. Mutations in this gene are associated with an increased risk of atypical hemolytic-uremic syndrome. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930435E12Rik A G 16: 38,827,863 Y295H probably benign Het
4931406C07Rik A G 9: 15,297,860 F46S probably damaging Het
Acaca T C 11: 84,338,356 Y1670H probably damaging Het
Acrbp G A 6: 125,053,832 R272Q possibly damaging Het
Adcy6 T A 15: 98,593,568 Q1050L probably benign Het
Amn1 C T 6: 149,185,031 M44I probably benign Het
Ankrd13b A G 11: 77,473,085 V395A probably benign Het
Ap3b2 T C 7: 81,477,072 K310R probably benign Het
Bnc2 T C 4: 84,506,574 D123G probably benign Het
Bst1 G A 5: 43,840,449 M263I probably benign Het
Ccdc7a C T 8: 128,889,811 G937E probably damaging Het
Cep290 A G 10: 100,537,553 M1232V probably benign Het
Dnah7c A T 1: 46,602,813 H1203L probably benign Het
Emc7 A G 2: 112,455,279 E71G probably benign Het
Exoc3l4 G A 12: 111,421,935 probably benign Het
Fam83c A G 2: 155,831,004 F278L possibly damaging Het
Gabpb2 C A 3: 95,200,225 V180L probably benign Het
Gbp2b G T 3: 142,603,609 Q160H probably benign Het
Gm19965 C G 1: 116,822,229 Q547E unknown Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gon4l T A 3: 88,902,807 D1774E probably damaging Het
Gpr15 A C 16: 58,717,816 Y303* probably null Het
Greb1 T C 12: 16,711,996 D461G probably damaging Het
Gria4 T C 9: 4,793,950 N36S probably benign Het
Hacd1 T C 2: 14,044,791 I119V probably damaging Het
Ing5 T A 1: 93,812,433 D101E probably damaging Het
Irak4 T A 15: 94,558,828 N297K probably benign Het
Itga7 A G 10: 128,953,501 D971G probably benign Het
Klf5 A G 14: 99,313,178 E397G possibly damaging Het
Krtap29-1 C T 11: 99,978,198 G286S probably damaging Het
Lrp2bp A T 8: 46,020,527 probably null Het
March4 T G 1: 72,447,220 Q266H probably damaging Het
Med23 A G 10: 24,905,965 T1056A probably benign Het
Megf11 T C 9: 64,706,632 L1079P probably damaging Het
Mycbp2 G T 14: 103,346,265 L85I probably benign Het
Nlgn2 G T 11: 69,827,885 Q290K probably damaging Het
Nox4 A T 7: 87,323,754 E323V probably damaging Het
Nup93 T C 8: 94,286,619 probably null Het
Olfr298 C T 7: 86,489,568 probably null Het
Olfr558 C T 7: 102,709,538 T93I probably benign Het
Olfr977-ps1 T A 9: 39,974,821 M1L unknown Het
Otop3 T C 11: 115,339,648 L117P probably damaging Het
Pde6c C A 19: 38,141,421 Q260K probably damaging Het
Plb1 C T 5: 32,247,557 Q20* probably null Het
Qser1 A T 2: 104,786,977 Y1163* probably null Het
Rbm12 A T 2: 156,098,217 I45N unknown Het
Rictor T A 15: 6,769,269 Y332* probably null Het
Rpp14 C A 14: 8,090,325 S83* probably null Het
Sel1l3 C T 5: 53,123,162 probably null Het
Setd2 T C 9: 110,567,840 probably null Het
Spink5 A G 18: 44,010,252 T759A probably benign Het
Spon2 T A 5: 33,217,456 E2V probably benign Het
Tdrd1 T C 19: 56,837,708 S144P probably damaging Het
Tex15 A C 8: 33,575,120 Y1526S probably damaging Het
Tnfrsf21 T C 17: 43,037,916 S140P probably benign Het
Trav6-2 T A 14: 52,667,442 M11K probably benign Het
Trp53bp1 G T 2: 121,247,814 probably null Het
Ttn T C 2: 76,734,827 N28352S possibly damaging Het
Uckl1 T C 2: 181,573,106 I292V probably benign Het
Unc13b T A 4: 43,216,333 S211T probably benign Het
Zcchc4 T C 5: 52,808,293 I313T possibly damaging Het
Zfp106 C T 2: 120,512,734 R1811K probably benign Het
Zfp599 G T 9: 22,249,892 Q326K probably benign Het
Zscan4e A T 7: 11,309,525 M108K probably damaging Het
Other mutations in Cfhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Cfhr1 APN 1 139556515 unclassified probably benign
IGL00656:Cfhr1 APN 1 139547755 unclassified probably benign
IGL01099:Cfhr1 APN 1 139547759 unclassified probably benign
IGL01101:Cfhr1 APN 1 139553584 missense probably benign 0.11
IGL01617:Cfhr1 APN 1 139553679 nonsense probably null
IGL01732:Cfhr1 APN 1 139550868 missense probably benign 0.02
IGL01935:Cfhr1 APN 1 139551002 missense probably benign 0.26
IGL02368:Cfhr1 APN 1 139547813 unclassified probably benign
IGL02456:Cfhr1 APN 1 139556393 missense possibly damaging 0.88
IGL03105:Cfhr1 APN 1 139547827 unclassified probably benign
R0681:Cfhr1 UTSW 1 139557511 missense probably damaging 0.99
R1466:Cfhr1 UTSW 1 139557574 missense probably benign 0.17
R1466:Cfhr1 UTSW 1 139557574 missense probably benign 0.17
R1829:Cfhr1 UTSW 1 139553600 missense probably damaging 1.00
R2082:Cfhr1 UTSW 1 139550886 missense possibly damaging 0.72
R2118:Cfhr1 UTSW 1 139550904 missense probably benign 0.01
R3747:Cfhr1 UTSW 1 139557634 critical splice acceptor site probably null
R3748:Cfhr1 UTSW 1 139557634 critical splice acceptor site probably null
R3749:Cfhr1 UTSW 1 139557634 critical splice acceptor site probably null
R4208:Cfhr1 UTSW 1 139547878 unclassified probably benign
R4566:Cfhr1 UTSW 1 139553648 missense possibly damaging 0.82
R4681:Cfhr1 UTSW 1 139550929 nonsense probably null
R4839:Cfhr1 UTSW 1 139560133 missense probably damaging 1.00
R5208:Cfhr1 UTSW 1 139556330 critical splice donor site probably null
R5572:Cfhr1 UTSW 1 139556427 missense possibly damaging 0.78
R6043:Cfhr1 UTSW 1 139550868 missense probably benign 0.01
R6176:Cfhr1 UTSW 1 139550916 missense probably damaging 1.00
R7689:Cfhr1 UTSW 1 139547740 missense unknown
R7852:Cfhr1 UTSW 1 139556427 missense probably damaging 0.98
R8120:Cfhr1 UTSW 1 139547845 missense unknown
R8376:Cfhr1 UTSW 1 139547811 missense unknown
R8433:Cfhr1 UTSW 1 139557538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGGCACTGAAGCATTAAGC -3'
(R):5'- TCCAACTTCATATTGAGGAGTTTGC -3'

Sequencing Primer
(F):5'- AGCAAAAGAGTACTTTCATTTTGTG -3'
(R):5'- CTTCATATTGAGGAGTTTGCCATAG -3'
Posted On2019-10-24